General Information
Symbol
Dmel\CG46314-RA
Species
D. melanogaster
Annotation Symbol
CG46314-RA
FlyBase ID
FBtr0452129
Feature type
Associated gene
Evidence Rank
Length (nt)
2515
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 126 )
Sequence
GTACTCAGTACAATTCGCTACTCAGACGCGAGCGCTCGAATTGAATCTCGGCTTTAACTTTGATTGCCGCCCCGCATTTC
ACACGTCTTGAACATATACGTCTTTACTCACCAACACAAAGAAAACGGCTTAAAATAAAACAATACAATAACAAATAAGA
AGAGAGGCAGTAACCACACAAGCACAGGTCTTCGCGTTTTATAAACGCTAAAAAGCCAATCGAAAATAAAAATATTATTA
AAAATGTGTTAAATAATTTATATGAAGGAAATCTGGTGTATCATTTAAAATAAAGTGCAGAATCTTTGCATTGAGCATTA
AAGCGGATACCGCTTTCCCACTTTGTGAAGTTGGCTGGCAGCGAAGGCCATTCGCACCTCTAACTTAAGCCACAGGGGAA
AACAAAACGGCTAGATTCCACTTGAGGTGATCATCGATTGGAAACTATATGTAGCCGAACCTCGGAAAATCTGCAGATTC
ACGGGACAATCGCGACCACCTGAAAGTTCGAGTGCGGGCTCCAAGGACTTTGTTAGCATGATACCACACTGTGGATACCG
TTACATGTGGAACCGTGAAATTGTGATAAACTCGCAAAAGTTGGTTAAACGACGCTAAGCAGGAACTTCAGATTTTCAAC
CACGCCGACCACTTTGCGGCAGCAGTTGAATCCTACGGACAGAAATCCAGCAACCGAAGGACAGACGCACAATAAAAACC
AATCACTCAAATCCCTTCATGCAATTTAAAACTTTTAATACTTTTCATATACGTTTTACCACGTTTTTACCGTTTTTACC
ACGTACCGTTTTTGTTTTTTATTTAATAAGAAAATGTGGTGAACTTATACCAGCCTAACCTACCCATTTTCCAGCTTTTT
ATTTGTACTTTCTAATTTGATTCTGTGATTTCTTACTTTCATTTGGAAATTTGATTATACATTACTGCTAATATTTTTTC
TATCTTCATAATATAAGGAATTCTCCTTTTAAATAGCTATTGTTTAAAACTCGATTATTGTTAGGTTTAGGTAAGTCTAC
TCATTTGGGGGTATATATATACCATTTACCGTCTTAATTTTTTTTTTTAATAAAAACTTGTGGGTTAACACTTAATATTC
GACAAAACGATTCACTGCTGCCGCAAAAATGAGCACCTATATATTTATGCAAGCATATGAATGTCTTTTGGACCAAAAGG
CAACGTTGAACTGCATCGATTATGACAGTAACAGCTTTCAGCCGAACATTAATGTTATAACTCAGGCCATAGTACCCGCA
AACAAAGTACAATTCGGTGCATCTTCAGACGCTGCTTCGCTTCCTTCTGCCGCTGATTACCAGCTCAATGATGGCCCATC
CCTTATTCTACAGCAATTAACGCCGCCGCAGTCTCCGCCTCAATTCGATGCTTACAAACAGGCGGGCGATGCACAGCCAA
AACCCGTGCTCGTAAAGGCCGAGCAAAAGGTGCAATGCTATACTCCTGATGTTACACACGCAGCATCTGCCACGCCCTTT
AACTTTACCAACTGGGTAGGCGGCAGCGAAATTGCCCGAGAGAACCAACTGGTCGATGATATCGTCAATATGCGTGCTAA
GGAGCTCGAATTGTCCACGAACTGGCAGCAGCTCAATGAGGACTGCGAGTCTCAGGCGTCTTCATCTTTAGACAGCAGAA
GCACAGGAAGCGGAGTGTGCAGCAGCATCGCCGACGCCGACGAGGACTGGGTTCCAGAGCTTATCAGCAGCTCCTCCTCG
CCAGCTCCTACAACCATCGAGCAGTCTGCGTCCCAGCCAAAAAAGCGTACTCGCACTTACGGGCGCGGTGTAGAGGATCG
AAAGATCAGGAAAAAGGAGCAGAACAAGAACGCTGCCACACGATATCGCCAGAAAAAGAAACTTGAAATGGAGAATGTGC
TGGGCGAGGAGCATGTGCTGTCTAAAGAAAACGAGCAGCTTCGTCGCACTCTGCAGGAGCGGCACAACGAAATGCGCTAT
CTGCGCCAGCTGATTCGAGAGTTCTACCATGAACGCAAGCGCTAGGCTTTATTTTCTTTGAAATCAATTTTATCGTCGTT
TGCAAAGTTATTGTTATAGTTAAACCCAAGCCTCTTCCATAAACTAATTGTCATCATAATGTTTCAATGTAATACTATCA
ATAACAATCTCCGGGTTGCCCAAAATCTACAAATCACCAAAGTACGCAGCCTGTCCTTTGTCCTACATTTTTGGCACTAA
TGACGAGTCTCTGAATTCGGAAATATTTGTTGCCAGTGGGGCCTAAAGGCGACCCCATATCCCAAGCAGCACGGTCCAAT
GTAAAAACACATTAATTGAAAAGCTCATTGATTTGTTTTTCTGCAAATCGGACAGTGTTGCGGCTGCTGTGCTATTTCAA
AAACACTTATATTTTTAATCTGGTAGCATCTCGAAAGATGTAGATTTATTTTAATGTTTCATTATTTTTTTCATATTCAA
CATTGATCAGTAATAAATCAAAGGGTTTTTAAAAG
Other Products of this Gene
Other Transcripts
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0402880
26
Derived from OTHER transcripts
Comments
Dicistronic transcript.
Transcript terminates at site supported by polyadenylated cDNA.
transcript_exception: dicistronic_mRNA
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG46314-RA
Secondary FlyBase IDs
    References (0)