General Information
Symbol
Dmel\RpL26-RC
Species
D. melanogaster
Annotation Symbol
CG6846-RC
FlyBase ID
FBtr0347494
Feature type
Associated gene
Evidence Rank
Length (nt)
1139
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 620 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      Sequence
      CTGTCAAATTTCTTTCTTTTCGTTGATTTTTCGACGCCCGCACAAGCAAGATGAAACAGAACCCGTTCGTGTCGTCGTCG
      CGCAGGAAGAACCGCAAGCGTCACTTCCAGGCTCCCTCCCACATTCGCAGGCGCCTCATGTCCGCTCCCCTCTCCAAGGA
      GCTGCGCCAGAAGTACAATGTGCGTTCCATGCCCATCCGCCGCGACGATGAGGTCCAGGTGATCCGCGGCCACTTCAAGG
      GCAACCAGGTGGGCAAGGTGGTCCAGGCCTACCGCAAAAAGTTCGTCGTCTACGTCGAGAAGATCCAGCGCGAGAACGCC
      AACGGCACCAACGTCTACGTGGGCATCCATCCCAGCAAGGTGCTGATCGTCAAGCTGAAGCTCGACAAGGACCGCAAGGC
      CATCCTGGAGCGTCGCGGCAAGGGTCGTCTGGCCGCTCTCGGCAAGGATAAGGGCAAGTACACCGAGGAGACCGCCGCCC
      AGCCCATGGAGACCGCGTAAATCGCCGGCTAAAACTCTGCTCTGGACAACTGGGACGTCGCTGTTTACTGTTTTTACCGT
      AACGCTTAGTGTAAAAAACAAAACATCTGAAAAAAATCGCGTGTGAAAACGGCGCCATTCTTTACAATAAAGGAAAGTTG
      ATTTTCACAAATGGATCTGTTGGCTTATTTCCCTGAATGAAGTTTTAGATAAATGTGCCGGAAAACCGACGTAGCTGAGA
      AGTTTTGGAGTAGTTTAAAAAGAGACGCTCTGCTATTTGTTTTGCAAAGATTATTGATGTTTGATTACTGCCCGATTAGA
      TTCTGTTTCAGATATAACTTATACTGCCATCTTCTCCATATTTTTGTTACTCTAAAAGTTAAAACCTTTAATTGACTTGC
      ATTAGCTTGAAATAGAGTTTTCATTGAATTTGGACTTATAAAATGCTGTATTTGGCATCCATCCATTCAAATTAATAGTC
      AAATGATTGATTTAAGTTAAGCTTGTAACCAAAAATCCAAAAATAGCAGATTTAATACGTAATGGCTACTTACATGTATA
      ATCGATCGTGTATTCCTACTATACAATCTTGATAAGCATCAACAGCAAACTTTCAAAGCTATTTAACTTTCCCAAAGAGT
      TTCATTTTGTAGGTAGAAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0075066
      648
      FBtr0333709
      652
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0312574
      149
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074833
      149
      FBpp0305858
      149
      Comments
      Extended 3' UTR based on RNA-Seq and/or EST data.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RpL26-RC
      Secondary FlyBase IDs
        References (0)