General Information
Symbol
Dmel\CG3638-RL
Species
D. melanogaster
Annotation Symbol
CG3638-RL
FlyBase ID
FBtr0347011
Feature type
Associated gene
Evidence Rank
Length (nt)
6097
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GTTATTGCACTCTGAACCGCGCGACGGTTGTCATCGCAGGACCGAATCGAATCCGAATCTCGAATAATTTTCAACTCGAC
      AGAGGCAGAGGTTTCGTTTCCGCAATCGCCGGGCTGGAAACATATATCCGTTGCATCTAACCGGATTGCGGCAGGGGAAG
      CCCCGTTTATCAGGATGATGTTCTGATATATTTCCTAAGCACCTCAGACGGTAGAAGTTGGGGAAGGAGTAGAAAAGCAG
      GAGGAGGTTGCGAATCGGAACGAATCGGAAACGAAACGGGTCGCGGCTTGAAACGAAACGCAGCGGCTCTCTCTTTCTCA
      GCGGCGGCAGCGTTCTGTGACGTCAGAAGCAGCGACGTCCTTCGCTGGCAGACGCACACACATACACACACCCACACGCA
      CGCACGCTCACTGACAGACACAATACCACACTTAGAGAAACTCCCACCAAGAGAACCCTCCCCCTCAGCAGCAACAACAA
      CAAGAACGACAACAGCTTCGCCAGCAGCAGCAGCAGCAACAAATTAAAGAGAGAGCACATTTATATTCCTTTGTGGCAAC
      GCGAGTGTATATGTGTGTGTGTGTTTCGAGGCAGCCGCACCACTACAACTGAAACTGCAACTGCACCAACAACAACAACT
      AAGCACATCAACATATAGCAACAAAAATGGAACAGCCGAGCATTCTCGTCAAAATCCTGCACTCGATTCCGCACGTGAAT
      TACACATTCCGTCGGGTTAACGACACCTTTAATCCGGACAGTGATGTTTACCTCGAGAGTCTGGTCATCCTGGCATCCAT
      TCCCGCTGGTCTGCTGATCGGCTCCCTACTGGGCCTGCTGCTCTACCTGCTGACCAGATGCTGCGATCGCCGCCAGAGGA
      AGCCGAGCGCCCAGCGCTGCCAGAGCTGCTCCTTGGTCATCATTACGCTGATGACCTGCGCCGCCATCGGATTAGGCTTG
      TACGGCAACGATGATTTCCATAATGGGCTTCTGCAGGCCTTTGGATCCGGGAAGAGCGTCGAGGGTCTGGTGCTCACCCT
      GAAACGACAGACGGAGAGCATCAAGCACGACCTGGAGACGCGAATGGCTGGGCATAAGGTGGAGCAGCTGGTGGAGAAGC
      CTCATTATAACCAGACGGTGGTCATGCTGCTTATTGAGACGTCGCGCTTGGTCACGGAGAACACCTCGCGGGCGGTGGCC
      TCGCTGGACAGCATGGTTCACTACTTTATGAAGGCCAAGGGCAGCGAGAACGACACCTCGCTAATGGGATTACTGCAGCT
      CGGTGAGTTCTACGAATCCATTCGCTGGCCAGCCACCCTGGCCTTTCTCACTGTGCTCCTGCTGCTCTGTACGGTGTTGG
      TGATCGGCGTGGCGAGGCGATCCCGTTGCACCCTGATCTTCTTCAGCGTCTCGGGTCTGTTCTGCATCATCATCTGCTGG
      CTGCTAGCTGGCGTTTATTTGGCCTCCAGTGTGGCTGCCGGAGATTTCTGTATGCGGCCCCACGACTATATGTGCCGTCA
      GGTGGGCATGAGAAGTCCCTATGTTGATTTTCTAAACTGCGGCACACCGCGCAATCGCTTTATCCTGCGGCTAAACGAAT
      CCCGGGACCTGGTGGATCGGGCCAGGGAAAGTGTGGAGCATATGCAGCGCATGAGTCAGGAGACATATCCACACATCGAC
      ATCCAGCGCACTTTGAACGCCATGGACAACGATCTAGAGATCACCCTGCGCAACCTGACGACACTGTCGGCCACATTGGA
      CCGCCGCACGATCGACATGCACTACGAGGAGGCACTGCGCGGACTTTGCGGCGGCGGGCTACTGGGACTCAGTCTGATGA
      TGGTGGCTGGTCTGCTGACCTCCTTCCTGCTGACGATCCTCGTGTATGCCGATTCTCACGCCTGGATCTATCTGACCAAG
      CGGCCTACGCTGGACGCGGACAAATCGGAGACAGCGCCACTATTTCCCGCCTCAAACGCGCCGAGCGCGAGCATCTCGCC
      CACAGCTCCGCTCAGCACGGGGACGATCAACAGGACGTTGCTCCACCACCAGCAGGCGTCGTCGGGCGGCGGTTCGGGTA
      CCTTGCCGGGATCTGGGGGAGGCGCAGGGGCTGGCGGAGGCGTTGGCGCCAATGGACACAATGGCGTGGGGCCGTACCGC
      AACGGATCGGCGGGCCTGAGACAAGGGTTGGCATCACCTTCATCTCAATCAAGCCACACCTCATCCACCGCTACTTACAA
      CAACGGCACCACCAGTTACCACAACAGCCACCAACAACACAACAACCACCTGTACAGCAACCACTACAGCCACAGCAACA
      ACCACTACAACAACACACAGCATAGAACTAACCCTGCGGCGGGGGCGGTAGCAGCGGCGGTGGGCGTGGTCAGCAGTGGC
      CAGCGATCACCGTCGCCGCCGCCTGTCTACGATTTGGTGCATGGCACAAGGTCAGGACACCACACGCTAGGACGCCTTCC
      ATCGCACCACCAGCAATCGGCGACGTATTTGCCAGGACCCAACAATGGAAAGTACGCGACGCTCAGCAAGCAGTGTAAAA
      CGCTCGAGTCCAACGACTTCTACTGAGATTCGCTTGCCTGCAGTTCCCATGCAGGCAGTAGCAGCAACACAGCACAGCAG
      CAGCAGCAGAACTTGCAGCTCCAGCAGCACCAGCAGCAGAGCAACCTCATCAATCAGAACCAAAGCCAGAGCACGCTGAA
      GAACATCTTTGCGTCGGCCACCCTGCCCCGCTCGACGGGCAGCTCCATTCGGTCCGTGCTCTCCGTTCAAACCTCCAATG
      CGGGCATTTGCCGCTCCACGGGCAACGGACTGGACGGCGACATGGTGGACGATCGCGATCCTAGGGATGTGACCAACAAC
      AGCTTCAATCGTTTCGACCCCAAGTACATAAGCATTGGCCCCAAAGCGGTGAGGGGTCAGAATAATAATTTAAATATTAT
      GTCCGTCGCCGGAGGTGCCAACAAGTGTGCCACCTTGCGGCATGTTGGTCGCTATGGTGGCTCGCTCAAGGGTGTGTCTG
      CCGTCAATGCCACGCCCTCGCCCGCCGCCGCCCCAGCTGTCCATTCGCCAAACTTGAGGAGCGCCAAGACGCCGTCGATA
      GCCACCGTTTCGAAGGATTATTGCCAGCAGCCGGACTGCATTCCTCAGGAGTTCCTCCTCCAGCAGCAGCAGCAGCAGCA
      GCAACAACAGCTGCAGCAGCAACAACAACAGCAGCAACAGCAACTGCAGCAGCAGCTTCAGCAGCAACAGCTGCAACTCC
      AACAACAGCAGATGGTGCCTCCCGCTCCGCCGCAACCGGCGCCTCCGCCTCCACCCAAACCAAAGATAGTCAATACGTTT
      ACGGAAATTCCCGGCACCACGGGCGTGGGCAGCTCGTATGCCAAGGAGCAGCAACAACAGCAGCAACTGTTGGCCCTGCA
      GCAGCAGCAGCAACAGCAGCAGCAACAGCAGCTGCTCACCCTCCAGCAGCAGCGCGAGCGGGAGCTGCAGCAACAGCAGC
      AGCAGCAGCATCAAAGGGAGTTGCATCCACCGACCACCCACATTCTACCCGCTTCGGCTGTCTACAGCATCGAGAGCAGT
      GAGGTGCTGCCCACAGCGGCACCGCGTGCGCAGCAGCGTTCGCTAAATCCCGCCTCCATTGTGAACCAACCGTTGCCCGA
      GATTCCCACCAATCAACAACAGTCAAAGATCTCCGCTCAGCCGCTTTGCGCCGCCAGCTTGGGGCAGTACCGCTCGCTGC
      AGCGTCCTCAAACCCAGAAATTGCAGCCGGCTGCCATCTCCTCGCCGCAGCAGCCACCAACGCTCCCGCCCAAGAACCGG
      CACAAAAACAGCAATCGCGGTGGAGCCATCGACAGCAGCAATGCCAATCATATGCAAACCTTGCCGCCCAAGTCAGCCAG
      CTTGAGACAACAACAACAACAGCAGCAGCAGCAGCAGGAGCGCGACAGGGAGCGAGAACGGGAGCGGGAGCGTCCGCGGA
      GGGCTGAGACCTTGGACAATGCACGCAGCTACATAGAACAGCAGCAACAGTATCCCAGCCATCTGATAACCAGCAGCAAC
      ATGAAGAAGCAACACTCCTATGACAGCAGCTACCATCAGCAGCAGCAGCAGCAGGCCTTTTATCAAAGGCAGCACAACAA
      CAACTTCTCATCGAAGCAGCAGCAACAGCTAATGCTGGAACAGCAGCAGCAGCAACAGCAGGCGCTGTTTTACAGATCCC
      TGAAACGGGGAGAACGCGTATCTACTGGCAGCGGAGGAGTTACTGGCGGAGGAGCCGCCATCAGCAACCAGAGCGATCTG
      TACTCGGTGACGGAGTTGTAGGAGTGCGCCTGCTGCGGCGGCGGTGTGGATGTGGTGCGCCGAGGCGCATCGTCCACATC
      GCTGCACGCGGCGGCGGCTACACAAACTCAGACCCACACCCAAAACCAGACGCAATCGCAGAACCAGGCGCCTGTTCCCC
      TGCCACCCAAGAAGCATCGCCAGCGGGAGAGGGAGCGCAACCTAGAGCGGGAGCAGCAGGCGCCCTGCAACGCCAATCTG
      TGTGAGGAGCACGAGTATGATGAGTTCTACCCCCAGGCCTATGAAATGCATGCGGTTGCAGGAGGAACTGGCGGTCCGAC
      GGGTGGAGGAGCGGTAGCTACTAGCTCTGCCTCTAAGCACGGCAAGCAAGGTCAGCAAAGAGCAGCCACTTTCGATGTGG
      CCGATGCCAGGGACTATGAACTGAAGCGTTTGGGCAACCGAAGATCGCAGCAGCAGGCGGCTCCGAGCAAGAGAAACGGA
      GGAGCAGGTGCACCGATTGTCAGTCAGGATCACCACCGCAGCCACGATCGCGAGCGGTCGCGGAGCGATCACCGCATTGC
      CAGCTATGCCTGCGAAGAGGTCAACTCCTCAGCGCTCTGCAGCGCCGGCTCCATGAGCTCCATGCTGCAGCCAGCCAATG
      GAACTACTGGTCACAGGAGCAGCAGTCACCAGCACCAGCGGGATCACCATGCGCGGGATCAGCAGCAACAGCAGCAGCAA
      CAACAGCAACAGCGGGAGCGACGCGAGAAGACCTTTAAGGTATGATTTTTAGAGACGTCATAAGAATTGTCCAATCCGCG
      CCAGGACACCAGAAACGGCAGCTCCCGGCGGCGGACGCGTTGAGAGGTAAATGGAAAGCTAACGTGGCGGATTCTACAGC
      GATTACGAGAAGGTGAACCCCCAGTTGAGCAAAAGGAGCGGCGCCATTGTAGGAATCATTGGTATCCGGAGATCCCAGCT
      TGTTTTTATGTTTAGCCTAAGTCGCGTCTTACTCTATGTCTATCTCTATCTCTGTCCATGTCTACCAGCGTCCTCTCCCT
      TTCACTTGCGTGCGAAAACGACTCACACACACATGTATATATACAAGTATATATGTACACCCAGATTGTATTGTAAAAAA
      ACCGACCTCTTCTGATTGATTCAAGTTGTAAAAGCTGCTTGAAAGGGGCTGCAGTGTCGAAGGTAGCGGTCGAAACAAAA
      GCGCATTGTAGTCACTTCTTTATTTTTGAATTTTAAAATTGTTTTATAGTGCAACATTTCATATGGCCATATGCCATTTG
      GCATTCCCTAAATGCCATTTATCACAAGCAATATTTACAAACCCTTATCTAATGATAATTGCTTGGAATTCTGAACCACG
      CTTCTCTTCGAGTCTGTCTTATTGTGCTATTGCCTTGACCGCTGCTGTGCATACAGCCATGTACACCCAACCTACAACAG
      TTCTCTGCCCTGTGTTGTTGCCTATTGTTATATAAATAGTAGAAAACTACGATTAACCGTAACGAATACTTTTTTGTGAC
      CACTATTCATACGTGTATATTTTAAAAAGCCTAAGTTAAGTGGAATTTAGTTCTAAGCGCAAAACTATTTATTTACGGCA
      ATTTGTAAGCCTCGACCCCAAAAATAATAACCAAAACGGTGGAAAAGCGAAGACACAGTCGGCGAAAGATGACTAGGTGC
      TCCTGAACATTTCCAAACGAGTTTTCGTTCAAATATTCCCGGGAATCTAAGTCCGTCTTTGTCTCGGCTTTTCGCTGTTT
      GAGGACCTTTAATTTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0070249
      8332
      FBtr0308707
      6037
      FBtr0330205
      6097
      FBtr0330206
      6636
      FBtr0330207
      6755
      FBtr0336978
      8745
      FBtr0346960
      6636
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0312444
      1224
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0070239
      639
      FBpp0300913
      639
      FBpp0303238
      1472
      FBpp0303239
      1136
      FBpp0303240
      586
      FBpp0307920
      655
      FBpp0312424
      551
      Comments
      Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.
      Transcript terminates at site supported by polyadenylated cDNA.
      GC splice donor postulated.
      translation_exception: stop_codon_readthrough
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG3638-RL
      Secondary FlyBase IDs
        References (0)