General Information
Symbol
Dmel\Ets21C-RD
Species
D. melanogaster
Annotation Symbol
CG2914-RD
FlyBase ID
FBtr0345429
Feature type
Associated gene
Evidence Rank
Length (nt)
2892
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATGACGCGGCAAAGGCAACAAGACAACAAATCCAAATAGGAGGGGAATCGATGAATGAATGAATTTTCGTTGGCCCCCAA
      ACGACCTTCCACCCGAGCCACCCCCTGTGGCCCACACACAAGGCTGGGGAACTCCGTCGGCTTCCCGCCGATCGACGATC
      GCTGTGCTCAATGGACGGGTGACTCATACGGACTAGGCCAGTTTCACGACGTCATGCTTAAGGTTGTTATTTGCTTTGCG
      AGCGAGCGATAAGTGGGCACTGCGGAGAGCGAAAGCTCGCGAGCCGAGTGGCAAACGCCGCCGGCAAACTGGTCCCGAGC
      AGCCAGTGCCCCTCGAAGTCAGCCGGTTGGTCATGGGGCAGCCGAGTCGGCGAGAGAGCGCCAAGTGGAAAGCTCATGGG
      AGCCGACTTCGTCATGGCTTTATCACTGTTCGCCGGCGCTGATCATTAGTTCGTCACTCGCCAAGTGGGTCGGATCAGGG
      CCAGAGCGATCGAAGATCGGCGATCTGGAGTGGAATACGGCGCTACTCTTAACCCGATCGGCGGATCTGTAATCGGTCGA
      TGCAATAACGGTTATTAAACGTTTCCAATCGCAAACTTTCCGCGAAAGATTTCCGCGATTTGCGGCACGTGGAAAGCCTG
      CCGCTGACTCCACTTGTCCGGTCAGCAGGTGAAATACCCTGACTATCTCGGGTGAATCATCCAGCCAGACGAACACACAT
      CCTAAATCCGTTTCAACCGGTTGCAGGCTACCAATAAACGCAATAATGCGAAAGTGTGATTCCTAGAATATTATGATTAA
      ACAGGGCCAAAGTGAAGTGAATATTCTAGTAGTGCAAAAGGGCGCCAAAAACATAAACAATAAAGTGTAATTAAGTGCAC
      TTACCAAAAATCAAGCTGGTATAATGAAATCTTAGTGAAAATCAAACAATAAGCAAATATAGATTAGATGAATTTATATG
      CCAACCGAATAATGTCAAAGAAAAGTGAAACGGTAAAGCTACCAAAAGTCTTTAGCTAATAGCTGATATTGCACTTTCGA
      AGTGGGAGCAGGAACATCCCAGCTTAATGGCCATTCTACAGAATAGCCGCCAGAGCCACAAGCAACTCCCAATCATCAGC
      CAGACGATTCGCAGTGCTTGGTGCCAACAGAGGCCGATTAATGCCATGCATCAGGATGTCCGGCAAAAAAGCATCGGATC
      CGGAAACGAGACCAAACTGGAAGCGAAGGAGACGGAAGTTCCCACCAACAGAAGAAGACGCAGAAGGCGTTGCAGCAGTA
      GCTCCACCAGCGACTCAAGCGCATCCTCATATTCCTCAACAGACTCGGATTCCGGGTCCTCCACCAGCAGCAGTAGCATA
      AGAAGCCAATTACCCGCCCTCAACTTGCCAGTGCCCCTCCCGCTGGCGACACCCACTCCGCCCGCCGTTTCATCGCCTCA
      CCAGGCGCCATCTCCTCGAAGGAACTCCAGCGACTCCAACCGGAGCGTCTCTCCCGTGGAGGTGCCCGTGGATCCGCACG
      CTTGGACGCCCGAGGACATTGCCAGCTGGGTGAGATGGGCGACGCGCAAGTTCAAACTGGACCCGGAGCCGGATATCGAC
      AGGTTTCCCAAGGATGCCCAGGAGCTGTGCGATCTGTCTCGCGCGGACTTCTGGGTCTGTGCAGGATCAAGGCGCGGAGG
      CATGCTCCTGGCGCAGCACTTCGCGATCAGCTTATACCACGCCACCGGACGGGAGACGAGTCCGATGCTCAACGACGACG
      AACCAAATCCGTACCAGCTGCTGAACGCTGCCTCGCACCGATTGGTTGCCCAAGGCTCAGGGGGCCAAATCCAGCTGTGG
      CAGTTTCTGCTGGAGCTGCTCGCTGATTCGTCCAACGCGAACGCCATCAGCTGGGAGGGCCAATCGGGCGAGTTCCGGCT
      CATCGACCCGGACGAGGTGGCCAGGCGGTGGGGCGAGCGCAAGGCCAAACCGAACATGAACTACGACAAGCTGAGCCGGG
      CACTCAGGTACTACTACGACAAGAACATCATGACCAAGGTGCACGGAAAGCGGTATGCCTACAAGTTTGACTTCCACGGT
      CTGATGGCCGCATGCCAGGCTCAGGCGCAGGGAGGAGATCCGGCCTCCAGTATGCTGGGTTCCTACAATCACCACGCCGG
      CGGTGCGATGCAGTTGGGCCGCCACCCGCCGCCACTGCACCACCATCCACAGCACTCACATCCGCACCACCAGCTGGGGC
      AGCCCCACTTTCTGCACCCGCACCACTCGTCGCCCGCCTCGAACAGCTCCAGCCTGGGATTCCCCTCGTCCTCGACGGCC
      TCTTCGCAGGCCTCGCCCGGCCAGGCGCCCGCCTCCTCCTCCGCCTCCACTTCGAATTTTACTGCTCCATTCCAAGGTGG
      GACAGCCGGCGTAGACCCGGCCAGGACGTCCACATCTTCTGCGGGAAACTACGACCAGGGCCCGGTCACTCCCACCACAA
      ATGCATTCAACTGAGCACGCCGCAACCCCAATTTGTCGCCGGGGTTGTAAGTTCCGATGGGGCAGGAGGATGCGCAGGAC
      CACCCACTGCGGCGCAGCAAAGAGCGGAGAGCCACCCTGCATCCCAGCCACCCATCCACCCATCCACCCAGTCCCCCAGC
      TATTGGGGGTCAGAGCTTCGGCCGTAAAAAAGGTCATTTTGTGTAATTCCAGCTACTTTGGGTTAATTGAGGAATTGTGA
      TAGCCCGTAGCATCGCAGAGCAATACTCGGAAACGAGAGCCAATTTGTTACTTAGCCTGTTATCCTTCGCTTCTAGTTGT
      AAGCAGACATTCGGCAGAGGTCCTTTATTCCATACGAGGTCTCATCATTAAATAATTATAAGTTCGCACACACATTAAAT
      ACATGAAATCGC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0078079
      2423
      FBtr0112854
      1603
      FBtr0344014
      4461
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0311554
      475
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0077739
      475
      FBpp0111767
      305
      FBpp0310465
      475
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      5' UTR based on RNA-Seq data.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Ets21C-RD
      Secondary FlyBase IDs
        References (0)