General Information
Symbol
Dmel\trol-RAK
Species
D. melanogaster
Annotation Symbol
CG33950-RAK
FlyBase ID
FBtr0342810
Feature type
Associated gene
Evidence Rank
Length (nt)
13414
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
Sequence
AGTTCAACGTGAAGCGTTTGCGTGTGCGTTACGTTGGCGCGACTTTGGCTCCAGCTCAACAGTATCAAAAAAAACATCCT
TTACTCTCGATTCGATTCTTCAAGAAGTCGGCCCAGTCGTTGTTCGAGAAACGTTTTTTTTCCTAGCTCGCGCTTCCGCA
TCCACATCCGCATCCGCATCTCGCATCCGCGATGGGACGGCGCCTGAGGGCAGCTTTTTGGCTGCTGGCGGTCCTGATCG
TCATCGAAAAGCCCCAAAAAAGCGTTGCACGCGGCACGTACCTCAGCTACGGTGAGTGCCAGGCCAACGAGTTTAGATGC
AATAATGGCGATTGTATCGATGCCAGAAAGCGTTGCAACAACGTTTCGGATTGTAGCGAAGGCGAGGACGAGAACGAGGA
GTGCCCCGCCGCCTGCAGCGGAATGGAGTACCAATGTCGCGACGGCACGCGCTGTATCAGTGTGAGTCAGCAATGCGACG
GTCACTCCGATTGCAGTGACGGCGACGACGAGGAGCATTGCGACGGAATTGTACCCAAGCTACGATACACGTGCCCCAAG
GGAAAATTTACGTGCCGGGACTTGAGCTGCATATCGATTGTTCATCGCTGCGATGGTCGGGCCGATTGTCCGAACGATCG
ATCGGACGAGGAGGGCTGTCCCTGTCTGTACGACAAGTGGCAGTGTGACGACGGCACCTGTATAGCTAAGGAACTACTCT
GCAATGGCAACATCGATTGTCCCGAGGACATTTCCGATGAGCGCTACTGCGAGGGTGGCTATGATAGCGAGGAATGTCGG
TTTGATGAGTTCCATTGCGGGACTGGTGAGTGCATACCAATGCGTCAGGTGTGCGATAATATCTACGATTGCAACGATTA
TTCCGATGAGGTTAACTGCGTCGAAGGAGAAGAGGAGGATAGGGTGGGCATACCCATTGGCCACCAGCCGTGGAGGCCAG
CGTCCAAGCACGACGACTGGCTGCACGAAATGGACACCAGCGAGTACCAGGTGTACCAGCCAAGTAATGTCTATGAGAAG
GCCAATTCTCAAAATCCATGTGCAAGCAACCAATTCCGGTGCACCACGTCGAATGTTTGCATACCGCTGCATTTGCGCTG
CGATGGCTTCTATCACTGCAATGATATGAGCGACGAGAAGTCCTGCGAGCAGTATCAGCGTCACACCACTACACGACGCC
CATTGACCTTGGCCACGCCCACCTCGAGAATCACCACCCAGGGCCCAGGTCTTCTGGAGCGTCGTAATACCACCACAGCC
ACCGAAGCATCGCGATGGCCATGGGCAACGAAAACGACAACAATCGCGACCACGACTTCTAACCCAATAACAACAGTTGG
CGTAGCGAACAGCCCACCCCAGACATGCCTCGAAAACATCGAATTCGCGTGCCACAATCGCGATTGCATTTCGATTGAGA
GCGTCTGCGATGGCATCCCCGACTGCGGACGCAATGAAGACGAGGACGACGCTCTGTGCAAGTGCAGCGGCGACAAGTAC
AAATGCCAGCGCGGCGGAGGCTGCATTCCGAAATCCCAGGTGTGCGATGGCAAACCTCAATGCCACGACCGCAGCGATGA
GAGTGCATGTCACCTCCATGGAAGGTTAAATAAAACTCGTTTGGGGGTCAAGTGCCTGGAGAGCCAGTATCAATGTGGCG
ATGGAAGCTGCATCTCCGGCTACAAGCGCTGCAATGGCATCCACGATTGCGCCGATGCCTCCGACGAATACAACTGCATC
TATGACTACGAAGACACCTACGACACCGACCCGAACAACAATCCATTGAATGAATGTGATATCCTTGAGTTTGAATGTGA
CTACAGTCAGTGTTTGCCGCTAGAGAAGAAATGCGATGGCTATGCAGACTGCGAAGACATGAGCGACGAGCTCGAATGTC
AGTCGTACACAGACCATTGTCTAGAGTCTGAGTTCGAATGCGATAGCTACTGCCTGCCCCGCGATCAGTTGTGCAACGGA
ATACCCAATTGCCAAGATGGCAGCGATGAGCGCAACTGCACCTTCTGCCGGGAAGACGCCTACCTTTGCAACACCGGCGA
GTGCGTGGCCGATAATCAGAGATGCAACGGCATCGCCGATTGCGCCGATGGCAGCGACGAGCGTCACTGCGCAAGGATAT
ATTGTCCACCTAACAAACTAGCCTGCAATGGCACTTGTGTCAGTCGGAGAATAAAGTGTGATGGCATCCGCGACTGCCTC
GATGGCTATGACGAGATGTACTGTCCGGAGACCAACAACCACTATCCCACACAAAATGTGAATGTTATACGACCAAAACT
GGGCCCCAATCCTATACCAAAATCGTGCCGCCCCCATGAATGGCAGTGTGCGAATCTCGAGTGCATCGATAGCAGTTTGC
AGTGCAATGAAATTAAGGATTGTTCCGATGGATCCGATGAGGAACTCAGCGTTTGCTTTGGCACTGCCACCACCCGACTC
AAGCCCAGCGACTGCAGTCCGGAACAGTTCTACTGCGATGAGTCGTGCTACAATCGATCCGTTCGATGCAATGGGCACGT
GGATTGCTCAGATGGTAGTGATGAGGTGGGCTGTTCACTGCCATGTCCGCAACACCAGTGTCCCAGTGGCCGGTGTTATA
CGGAAAGTGAACGATGCGATCGGCACAGACACTGCGAGGACGGCTCCGATGAGGCCAACTGCTGTTACGCAAACCAATTC
CGTTGCAACAATGGTGACTGCGTTTCCGGATCGGCTCCCTGCAACGGATATTCCGAGTGCAGTGATCACTCCGATGAGCT
CAACTGTGGTGGAACCCAGGAGTGTCTGCCCAATCAATTCCGCTGCAATAGTGGCCAGTGTGTGAGCTCCTCAGTGCGAT
GCAACGGACGAACCGATTGCCAGGATAGCTCCGATGAGCAAAATTGCGGTCATCGTCATACAGAGGTCAGTCAAGGCCTG
GAAACCACTGGAGTTTTTACCACCTCCACGACCAGCACCACTGCCATGACGCCATTGAGAATCATCTGCCCGCCAACCTC
ATTTAAATGCGAAAATGGTCCCTGCATTTCGCTGGGTCTCAAATGCAATGGACGAGTTGATTGTCCCTATGATGGTAGCG
ATGAGGCGGATTGTGGTCAAATTAGCAACGATATCGATCCCGCCGATAGTAATGATCGCAGACCGAACCAACTGAATCTC
AAGACCTATCCCGACAGCCAGATCATCAAGGAGAGTCGCGAGGTCATCTTCCGTTGCCGAGATGAAGGACCCGCACGCGC
CAAGGTCAAGTGGTCCCGCCCAGGCGGACGACCACTGCCACCTGGTTTCACCGATCGGAACGGCCGCCTGGAGATTCCCA
ACATTAGGGTCGAGGATGCCGGCACATATGTTTGCGAGGCTGTGGGCTATGCCAGCTATATTCCCGGCCAGCAGGTCACC
GTGAACCTCAACGTCGAGCGCTATAACGACGTTGGATCCCGTCCGGAATCAGCCTGCACGGAATATCAGGCCACCTGCAT
GAACGGCGAATGTATTGACAAGTCGTCCATCTGTGACGGAAATCCGGACTGTTCGGACGCCTCCGATGAGCAAAGCTGCA
GTTTGGGTCTCAAGTGCCAGCCCAACCAGTTCATGTGCTCGAACTCGAAGTGCGTGGACCGCACCTGGCGATGCGATGGC
GAGAATGACTGCGGAGATAATTCCGATGAGACCTCCTGCGATCCGGAGCCAAGTGGCGCTCCCTGCCGCTATAATGAATT
CCAGTGCCGCAGTGGTCATTGTATACCCAAGAGCTTCCAGTGCGACAATGTTCCTGATTGCACGGACGGTACCGATGAAG
TTGGATGCATGGCACCCTTGCCAATCCGCCCTCCACCCCAATCTGTTTCCCTTTTGGAGTATGAGGTGCTCGAGCTTACG
TGCGTGGCCACCGGAACCCCAACTCCCACAATTGTATGGCGTCTGAACTGGGGTCATGTGCCCGATAAGTGCGAGTCAAA
GAGCTACGGTGGAACGGGAACACTTCGTTGTCCGGACATGAGGCCGCAGGACAGTGGAGCCTACTCGTGCGAAATTATTA
ACACACGCGGCACCCACTTTGTGAACCCGGACACCATTGTTACCGTTAGACCAGTGCGTACAGATGTGTGCGAGGCCGGA
TTCTTCAATATGTTAGCCCGCAAAGCGGAGGAGTGCGTCCAGTGCTTCTGTTTCGGAGTAGCTAAAGCCTGCGACAGTGC
CAACTTATTTACATATGCCATCCACCCGCCGATCCTTTCACACCGCGTTGTCAGCGTTGAGCTGAGTCCACTTCGACAGA
TTGTGATCAATGAGGCAGCGCCAGGACAGGATCTGCTCACACTGCTACATGGCGTTCAGTTCAGGGCCACCAATGTTCAC
TTCAGCGGCCGGGAGACGCCTTATTTGGCCTTGCCCGCGGATTACATGGGCAACCAGCTAAAGTCTTATGGCGGAAATCT
ACGATACGAGGTTAACTACCGCGGCAGCGGAAGACCCGTCAACGGTCCAGATGTAATAATCACTGGCAATCGTTTTACAC
TAACTTATCGAGTTCGCACTCAGCCGGGTCAAAACAACAGGGTGAGCATTCCATTCGTGCCAGGTGGATGGCAAAAGCCC
GATGGTCGCAAGGCGTCGCGTGAGGAGATCATGATGATTCTGGCCAATGTGGACAATATCCTGATCCGACTCGGATATCT
GGATAGCACCGCTCGCGAAGTGGATCTTATAAATATTGCCTTGGATTCGGCAGGCACTGCCGATAAGGGACTGGGTAGTG
CGTCTCTTGTGGAGAAGTGCCAGTGCCCACCTGGTTATGTTGGTGATTCGTGTGAGTCCTGTGCCTCCGGCTATGTGCGA
CAGCCCGGTGGACCATGGTTGGGTCACTGTGTGCCGTTCATCCCTGATTCTTGTCCATCCGGAACTTATGGAGATCCCCG
TCGTGGTGTGCCCTGCAAGGAGTGCCCATGTCCACTAACCGGCAGCAATAACTTTGCCAGCGGCTGTCAACAAAGTCCTG
ATGGCGACGTGGTTTGCCGATGTAATGAGGGCTACACAGGCAGGCGGTGCGAACAGTGCGCCGCCGGATACCAGGGCAAT
CCTTTGGCTGCGGGAGGAATTTGCCGCAGAATACCCGATACTTCCTGCAACGTGGATGGCACCTACTCCGTTCATAGCAA
TGGAACCTGCCAATGCAAGGATAGCGTAATTGGCGAACAGTGCGACACATGCAAATCAAAGAGTTTCCACCTCAATTCGT
TTACATATACCGGTTGCATCGAGTGCTTCTGCAGCGGAGTGGGCTTGGACTGTGATAGTAGCACGTGGTATCGCGATCAA
GTAACGAGCACGTTTGGAAGATCTCGTGTCGATCACGGATTTGTTTTGGTTACTAACTACATGCAACCCACGCCAGACAC
CGTACCTGTCTCAATGGCCGCAGAACCCAATGCGTTAAGCTTTATAGGATCGGCTGATCAATCTGGAAATACGCTCTACT
GGAGTCTGCCAGCCGCCTTTTTGGGAAACAAACTTTCTTCATATGGAGGCAAGCTGACTTACACCTTAAGCTACAGTCCC
CTGCCCAACGGCATTATGTCTCGGAACAGTGCCCCAGATGTGGTGATCAAGAGTGGCGAGGATCTAAGGCTCATCCATTA
TAGGAAATCCCAGGTTGTGCCCAGTGTGGCCAACACCTATTCCGTGGAAATCAAGGAAAGTGCTTGGCAGCGCGGCGACG
AAGTTGTGGCCAACCGTGAGCACGTTCTGATGGCACTTAGCGATATTACGGCCATCTACATAAAGGCCACATACACCACT
AGCACCAAGGAGGCCTCGTTGCGACAGGTGACTTTGGACGTTGCCACTCCAACGAACCTTGGCACTCCACGTGCCGTCGA
AGTTGAACAGTGCCGCTGTCCCGAGGGCTATTTGGGTCTTTCTTGTGAGCAGTGCGCTCCTGGCTATGCCCGCGATCCGG
AGGGCGGAATCTATCTGGGACTCTGCAGGCCTTGTGAGTGCAATGGACATTCCAAATATTGCAACAGCGATACCGGTGAC
TGCGAAGAATGTTCTGACAATACCGAAGGTCCTAGCTGTGAACGATGCGCTGCTGGCTATGTGGGTGATGCCACCCGTGG
AACAATTTACGACTGCCAACCCGATGAAGGCTACCCGATCCCGAGTCCTCCGGCACCCGGCAACCAAACTTTGGAATGCA
CGGCCTATTGCCAAATAGAGGGCATCTATGATTGCCGCGGCAACGAATGCCTGTGCAAGAGAAACGTGATTGGTGATCAA
TGCGACCAATGCCGCCCTGGAACCTATGGACTGTCTGCTCAAAATCAGGATGGCTGCAAAGAGTGCTACTGCTCTGGATT
GGCCAGCCAGTGTCGTTCGGCAGCTCTGTACCGCCAGCTAATACCGGTGGACTTTATTCTTAACGCACCATTAATTACAG
ACGAAAGCGGAGCTGTCCAGGACACCGAGAACTTAATTCCCGACATATCTAGGAATATGTATACCTACACGCACACCTCC
TATCTGCCCAAGTACTGGAGTCTTAGGGGAAGTGTGCTGGGCAACCAGCTATTCTCGTACGGTGGCCGCCTGTCGTACAG
TCTAATAGTGGAGTCATATGGCAACTATGAGCGTGGCCACGATATTGTGCTTATTGGCAATGGATTGAAGCTCATCTGGT
CGCGACCCGATGGAAATGAGAATCAGGAGGAATACAATGTCCGATTGCACGAGGACGAGCAATGGACCCGCCAGGATCGC
GAATCGGCACGACCGGCTTCTCGGTCTGATTTCATGACTGTGCTGTCGGATCTACAGCACATCCTAATCCGAGCCACACC
CAGAGTGCCCACACAAAGCACTTCGATCGGCAATGTCATTCTGGAGAGTGCGGTGACCACAAGGACGCCAGGAGCTACGC
ATGCTTCCGACATCGAGTTGTGCCAGTGCCCATCCGGATACGTGGGCACCTCCTGTGAATCATGCGCACCTCTTCACTAC
CGCGATGCTAGCGGATCGTGCAGCCTGTGTCCTTGCGATGTTTCCAACACGGAGTCGTGTGACTTGGTCAGTGGCGGATA
CGTTGAATGTCGTTGCAAGGCACGTTGGAAGGGCGATCGGTGTCGCGAGATCGACACATCGCCCATTATCGAAGATCCGC
CCCAGATATGTGATTTAAGCAGGGGATTCTGTTGCAGCGGCTTTCAGTTCGATATCGCACCGAATGAGACAATCTCGTTC
AATGACACACTGCAGATATATAAGGGCAACAGAATCATAGGAAATATGACCAAGCTGCGCTACGGCTGTCCATCGCGAGA
CACCAACGATCCAACGGATATCGGTACAGAAGATCCCGTGCTCACCCAGATTATCGTATCGATTCAAAAGCCTGAGATCA
CCATTGTGCCCGTAGGCGGTTCCATGACCCTCAGCTGTAGCGGTCGAATGCGTTGGAGCAATAGTCCAGTCATTGTGAAC
TGGTACAAGGAGAACAGCCGCCTGCCAGAGAATGTTGAAGTCCAAGGCGGAAATCTGTACCTGTACGATCTACAGGTCAG
CGATTCTGGAGTCTACATCTGCCAGGCCGTCAACAATGAAACCGCCAGCGTGTTTAAGGACACTGTATCCATTACCATAA
CCAAGAAAGACCAGCTCTCACCGGCTGAGATTGTGAATTTGCCGAGCCACGTTACATTTGAGGAGTACGTGAACAATGAG
ATTATCTGCGAAGTACTTGGCAACCCAGCACCCAGAGTCACCTGGGCGCGAGTGGATGGCCATGCGGATGCCCAAAGTAC
CCGGACATACGACAACCGCTTGATCTTTGATTCGCCAAGGAAATCGGACGAAGGCCGCTATCGCTGCCAGGCGGAAAATG
ACCAGAACCGAGATGAGAAGTACGTGATCGTCTATGTTCAGAGCAATCCGCCCCAGCCGCCGCCGCAACAGGATCGATTG
TACATCACACCGGAGGAGATTAATGGCCTGGCCGGCGAGTCCTTCCAGTTGAATTGCCAATTTACAAGTGTTGCCTCTCT
GCGCTACGATTGGTCGCACAATGGTCGCTCCTTATCCTCTTCGCCCGCGCGAAATGTTGAGATCCGTGGCAACACCCTGG
AAGTTCGCGATGCCAGCGAAAGCGACTCCGGCGTCTACACCTGTGTGGCGTATGACGTACGCACCCGCCGCAACTTTACC
GAGAGCGCCCGTGTTAACATCGACCGACGCGAAGAACAACCATTTGGCAACAAACCGATCATCGAGAGCTTGGAGCAGAA
TATCCTGATCATCCAGGGCGAGGACTATAGCATCACCTGCGAGGCGAGTGGATCGCCATATCCATCGATCAAGTGGGCCA
AGGTGCACGACTTCATGCCCGAAAATGTGCACATTAGTGGCAACGTGCTGACCATCTATGGAGCACGATTCGAGAATCGC
GGTGTCTACTCCTGCGTTGCCGAAAATGACCACGGATCAGATTTGTCCAGCACAAGTATCGACATTGAACCCCGGGAGCG
GCCGAGTGTAAAGATTGTATCGGCGCCCCTGCAAACATTTTCGGTTGGCGCTCCGGCATCCCTCTACTGCACGGTAGAGG
GAATTCCCGATCCGACCGTCGAATGGGTTCGTGTGGACGGCCAACCGTTGTCGCCGCGTCACAAGATCCAGTCACCCGGC
TACATGGTAATCGACGATATTCAGCTCGAGGATAGCGGAGACTATGAGTGTCGCGCAAAGAACATAGTCGGCGAGGCGAC
CGGCGTGGCCACCATTACCGTCCAGGAGCCAACTCTCGTCCAGATAATTCCCGACAACAGGGATCTTAGGCTGACGGAGG
GCGATGAACTCTCACTGACCTGCGTTGGCAGCGGCGTCCCAAACCCGGAAGTCGAATGGGTTAATGAAATGGCCTTGAAA
CGGGATCTCTACAGCCCACCGAGCAATACAGCGATCCTTAAGATCTACCGAGTGACCAAGGCGGATGCAGGCATATACAC
CTGCCATGGCAAAAATGAGGCGGGTAGCGATGAAGCTCACGTTCGCGTTGAGGTCCAGGAACGGCGAGGAGATATCGGAG
GAGTTGATGATGATTCCGACCGGGATCCCATAAACTACAATCCGCCACAACAACAAAACCCTGGCATCCACCAGCCGGGC
AGCAACCAACTCCTGGCCACCGACATTGGCGACAATGTGACCCTGACCTGCGACATGTTCCAACCCCTGAACACGCGCTG
GGAACGCGTCGACGGGGCACCACTGCCCCGCAATGCCTACACGATTAAAAACAGGCTGGAGATTGTGCGCGTGGAACAGC
AAAATCTGGGCCAGTACCGCTGCAATGGAATCGGTCGCGATGGCAACGTTAAGACCTATTTCGTTAAAGAGCTGGTCCTT
ATGCCCCTGCCCCGAATCAGGTTCTACCCGAATATTCCGCTGACCGTGGAGGCGGGTCAGAATTTGGATGTGCACTGTCA
GGTGGAAAACGTGCGTCCGGAGGACGTTCATTGGAGTACCGACAACAATCGACCACTGCCCAGTTCGGTTCGCATTGTGG
GCAGCGTCCTGCGCTTCGTGTCCATCACACAGGCAGCTGCCGGTGAATATCGCTGCTCTGCCTTCAACCAATATGGAAAC
CGATCGCAGATCGCAAGAGTGGCAGTAAAGAAGCCCGCCGACTTCCATCAGGTTCCGCAGTCCCAGTTGCAACGGCACCG
CGAGGGCGAGAACATTCAACTGCAATGCACGGTGACCGATCAATATGGCGTAAGGGCTCAAGACAATGTTGAGTTCAACT
GGTTCCGCGACGACAGAAGACCCCTGCCGAACAACGCCCGTACGGATAGCCAGATCCTGGTGCTGACCAATTTGCGACCC
GAGGATGCGGGTCGCTACATCTGCAACTCATACGACGTGGACCGTGGGCAGCAACTGCCCGAAGTGTCCATCGACTTGCA
AGTACTAACGGCTACCCCGCCACCCAACAGCCCCATCTACCTGCCACCGCAATTGCCAGCAAAGAGCCGCGACTATAGCC
TCAAACTGGACGATCAGTCCTCGAACCTGCGAGCGGGTGAATCCACCGATGTCGAGTGCTACTCCTCCGATGACACCTAC
ACAGACGTGGTGTGGGAACGCTCTGACGGGGCTCCACTCAGCAATAATGTCAGGCAAGTGGGAAATCGTCTGGTGATCAG
TAATGTGTCGCCAAGCGATGCCGGTAACTACGTGTGCAAGTGCAAGACGGACGAAGGGGATCTGTACACCACCAGCTACA
AACTGGAGGTCGAGGATCAGCCTCATGAACTCAAAAGCTCCAAGATAGTTTACGCCAAGGTTGGCGCCAATGCCGATTTG
CAGTGCGGGGCCGATGAAAGTCGACAGCCCACCTATCGCTGGTCTCGCCAATACGGCCAACTTCAAGCGGGACGCAGTCT
AATGAACGAGAAACTGTCCCTGGACAGTGTGCAGGCAAATGATGCCGGTACGTATATTTGCACCGCTCAATACGCCGATG
GTGAGACTGCAGACTTCCCCAATATCCTGGTTGTGACTGGGGCGATTCCCCAGTTCCGGCAGGAACCTCGCAGCTACATG
AGCTTCCCCACGCTGCCAAACTCTTCGTTTAAGTTCAACTTCGAGCTGACCTTCCGACCGGAAAACGGTGACGGTCTCCT
ACTGTTCAACGGACAAACCCGCGGAAGTGGCGACTACATCGCACTTTCGCTCAAGGATCGCTATGCGGAGTTCCGTTTTG
ATTTTGGTGGTAAGCCAATGCTGGTGCGAGCTGAGGAACCACTGGCGCTGAATGAGTGGCACACGGTTCGTGTGAGTCGC
TTCAAGAGGGATGGTTACATCCAGGTGGACGAACAACATCCGGTGGCCTTCCCCACCCTGCAGCAAATACCCCAACTGGA
TCTGATCGAAGATTTGTATATTGGCGGAGTGCCCAACTGGGAGCTCCTGCCCGCCGATGCTGTTAGCCAGCAAGTTGGCT
TCGTGGGCTGCATCAGTCGCTTAACTCTGCAAGGACGCACCGTGGAACTGATCCGTGAGGCGAAGTACAAAGAGGGCATC
ACGGACTGCCGGCCATGTGCGCAAGGACCTTGTCAAAACAAGGGAGTCTGCTTGGAGAGCCAAACCGAGCAGGCCTACAC
CTGCATTTGCCAGCCGGGTTGGACTGGAAGGGATTGTGCCATTGAGGGCACCCAGTGTACGCCCGGAGTCTGTGGCGCCG
GACGCTGCGAGAATACGGAGAACGACATGGAGTGCCTGTGCCCACTGAACCGATCCGGAGATCGATGCCAATATAATGAG
ATTTTAAATGAGCACAGTCTCAACTTTAAGGGCAACAGCTTTGCGGCCTATGGAACTCCTAAAGTCACCAAGGTCAACAT
AACGCTCTCCGTACGTCCGGCAAGTTTGGAGGACTCCGTGATTTTGTATACTGCAGAATCGACTCTGCCCAGCGGCGATT
ACCTGGCACTGGTACTGCGTGGTGGTCACGCGGAGCTCTTAATAAATACGGCAGCTCGATTGGATCCCGTGGTAGTGCGA
TCTGCTGAGCCACTGCCCCTGAACCGCTGGACAAGAATTGAGATCAGACGTCGCCTGGGCGAAGGAATTCTACGGGTGGG
CGACGGACCAGAGCGAAAGGCCAAGGCCCCAGGCTCGGATCGAATTTTGTCCCTTAAAACGCACCTCTATGTGGGCGGCT
ACGATCGCTCCACGGTCAAGGTCAATCGGGACGTGAACATCACTAAGGGCTTCGATGGCTGCATCTCCAGGCTATACAAC
TTCCAAAAACCTGTCAATCTCCTAGCGGACATTAAGGATGCGGCAAATATACAGAGTTGTGGGGAGACTAATATGATCGG
AGGTGACGAGGATAGCGACAATGAGCCACCAGTTCCGCCTCCAACTCCAGATGTTCACGAGAACGAACTTCAACCATATG
CGATGGCGCCGTGCGCCAGCGATCCATGTGAAAACGGAGGAAGCTGCAGTGAACAGGAGGACGTGGCCGTATGCTCCTGT
CCTTTCGGATTCAGTGGCAAGCACTGTCAGGAGCACCTCCAACTGGGCTTCAATGCCTCGTTCCGAGGCGATGGGTACGT
TGAGCTGAATCGAAGTCACTTCCAACCAGCTTTGGAGCAATCCTACACTTCTATGGGCATCGTCTTCACCACCAACAAGC
CGAACGGTCTGCTGTTCTGGTGGGGCCAAGAGGCCGGAGAGGAGTACACCGGACAGGACTTTATAGCTGCCGCAGTGGTG
GATGGCTATGTGGAGTACTCAATGAGGCTCGATGGCGAGGAGGCGGTAATCCGGAACAGCGATATCCGCGTAGACAATGG
GGAGCGACACATTGTGATCGCTAAGCGGGACGAAAACACCGCCATTCTAGAGGTTGATCGCATGCTGCATTCGGGTGAAA
CCCGACCCACCAGCAAAAAGTCGATGAAGCTGCCGGGCAATGTTTTTGTCGGTGGCGCTCCTGACCTCGAGGTGTTTACG
GGTTTCCGATACAAGCACAATTTGAACGGCTGCATTGTGGTCGTCGAGGGCGAAACTGTGGGCCAAATTAATCTTAGTTC
TGCTGCCGTTAACGGAGTGAATGCCAACGTCTGTCCCGCTAACGACGATCCACTGGGAGGAACCGAACCGCCAGTCGTCT
GAGGACACAACCAACAGCCGAAACTAGCTTTTTAATTAAACATTAACAAATGAAACAAAACGAACAACAATTTTTATATA
TACAACATATGCATAAGCCCAAGAAAATCCACAAAAATTGAATATTATATCACTTACACATAATATAAAAAAAACAAAAA
CAAAAGAGAAACGATCACTTCAACTACAATTGCTTCTTCGATCCTTAAGTCTAAGTTAAAGATTGTAGCAAGGAAAAATG
CGAAAATATCACAAACATTTATTTAACAAAAACGCCATGCAAGAAGTGAAACGAAACAGATACAATAATGCAACTAATGC
AAAATAATACAGAAAATACAGTTAAAGCCTAGAACCCTAAGAACTTACTAACTAACTCGAGCAACAACAACGCATACTAG
CCAACTGCAACCACAAAATCCACAATAGTGAAGGCATTTTAATCATAATTTTAGTCTCTAGCTTATACCTATGACTACGA
CTCTTTTTTTGCCAGCCCAGTGTAAAAAGTTGGAGATCGAAAATTGGCCCTACACACATACAAGACCACGTTATTGATTA
AAAACCAATTGATAATACACCTACATACATATAATGATAAATGAATTACTAAGAATGCAACTATTGTGAACGAGCGAAAA
CCGTTGAGTGGATAAAAGCGAATGCAGAAGATATATTAAAATGAAATCAACAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0342805
13571
FBtr0342806
14164
FBtr0342807
10594
FBtr0342808
14095
FBtr0342809
12553
FBtr0342811
12046
FBtr0342812
12763
FBtr0342813
13312
FBtr0342814
12523
FBtr0342815
12280
FBtr0342816
13759
FBtr0342817
13312
FBtr0342818
12277
FBtr0342819
14299
FBtr0342820
14215
FBtr0342821
12781
FBtr0342822
12883
FBtr0342823
13196
FBtr0342824
12361
FBtr0342825
12829
FBtr0342826
13471
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0309646
4176
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0309641
4223
FBpp0309642
4434
FBpp0309643
3105
FBpp0309644
4411
FBpp0309645
3897
FBpp0309647
3728
FBpp0309648
3967
FBpp0309649
4150
FBpp0309650
3887
FBpp0309651
3806
FBpp0309652
4299
FBpp0309653
4150
FBpp0309654
3805
FBpp0309655
4479
FBpp0309656
4451
FBpp0309657
3973
FBpp0309658
4007
FBpp0309659
2853
FBpp0309660
3833
FBpp0309661
3989
FBpp0309662
4203
Comments
Extended 3' UTR based on RNA-Seq and/or EST data.
Transcriptional initiation is supported by short-capped RNA data (FBrf0209722) and RAMPAGE TSS data (FBrf0220331)..
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
trol-RAK
Secondary FlyBase IDs
    References (0)