General Information
Symbol
Dmel\ReepA-RO
Species
D. melanogaster
Annotation Symbol
CG42678-RO
FlyBase ID
FBtr0336697
Feature type
Associated gene
Evidence Rank
Length (nt)
1321
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGTCTCTGCTCGGCGTTCTAGCGGCCAGGAACTATCTGCGATCCGTGCTGCGGGCAATGCATCCCCGTTGCCATGAGGC
          CAATCTATCAGCAGGAGCCGCCGCTCTTCTACCAGCGGCCAGCTAATCTCCGCCGCCTACGTCATCCGCCGGGCACCGTC
          TACGGACGCAGTTACTCGCTCGAGGACCAGCCAGAGGACGTGATACCCGTGTATCCAAAGTTTATCTACGCCCCACAACA
          GCAGCAACAGCAACAACGGGCCCCATATCCGCTGTATCAACTGGGCGACTCGCTGAGCTCGCTGGACAGCGATTTTCCCG
          AGAATGAGTACGCGGGTGCCTACATAGTGGAGGATCGAGTTCCGCTGGCCAACGCACCTACTCCCAAAGTTGTCCAGAAC
          CTCAATGCGTTGGGTCGAATGCTGGAGCTGCTGCAGCGCTGTCCTCTGCCATGCCTCTCCTTCAACACGGCCTGCATCTG
          CTCACTGATTGTCATATTCCTTGCGCCTCGCACTTGTGCCCAGAGTTTACTGTTTCCCGCTTTCAGATTGTTCTGCGGCA
          CCCTGTACCCGGCATATGCCTCATACAAGGCCGTCAGGACCAAGGATGTCAAGGAATATGTTAAATGGATGATGTACTGG
          ATTGTCTTTGCATTTTTCACCTGCATAGAAACATTCACGGACATATTTATCTCCTGGCTACCGTTCTACTACGAGGTGAA
          GGTGGCCCTGGTGTTCTGGCTCCTCTCGCCGGCCACAAAGGGCAGTTCGACTTTGTATCGCAAATTCGTGCATCCTATGT
          TGACGCGCCACGAACAGGAGATCGACGAGTACGTGAATCAGGCCAAAGAGCGCGGCTATTCGGCGGTCCTGCAGCTGGGC
          TCCAAGGGAGTAAACTATGCCACCAATGTCCTCATGCAGACGGCCATCAAGCGTCGTTGCATAAAGTGAGCAGCAAACAG
          ACATCAGCTTCTGCTGTTCTATATTCGAAAATTTGCGCAACACTCTCGCGTGCTCATCTTGATCATCGCCAACTGGCCAG
          CGAATCTGCAGCAGAGTGCGGGGAGCTCCTCGTCGGAGAATCATCAGCATCATCGCCTTCATCATTTGATCGCCTTCTCT
          TTACATTTACTTTTATTATTATTTAGTCTAAACGTCTAGATTGGAATGCTCTTTTGTGCCATTTGCGTGTTTGTTTTGGT
          TTAGTTTGTAGTGTGTTTCTCTTTGTGTAGCCCGATCACTATATAGACTATACGTGATACAAGCTGAAAGATAAATCAAC
          ATGTTGAAATAATGTAATAAAAACAATATCTGAACAAACCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0302766
          1573
          FBtr0302767
          1469
          FBtr0302768
          2534
          FBtr0302769
          2715
          FBtr0302770
          2755
          FBtr0302771
          2718
          FBtr0302772
          1931
          FBtr0302773
          1243
          FBtr0344190
          2601
          FBtr0345077
          2641
          FBtr0345078
          1863
          FBtr0345079
          1823
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0307678
          291
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0291906
          435
          FBpp0291907
          288
          FBpp0291908
          288
          FBpp0291909
          569
          FBpp0291910
          716
          FBpp0291911
          570
          FBpp0291912
          408
          FBpp0291913
          151
          FBpp0310602
          538
          FBpp0311307
          685
          FBpp0311308
          459
          FBpp0311309
          312
          Comments
          3' UTR based on RNA-Seq data.
          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG42678-RO
          Reep1-RO
          ReepA-RO
          Secondary FlyBase IDs
            References (0)