General Information
Symbol
Dmel\Whamy-RC
Species
D. melanogaster
Annotation Symbol
CG12946-RC
FlyBase ID
FBtr0334687
Feature type
Associated gene
Evidence Rank
Length (nt)
1832
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTCCCACAAGGTTCTCCGTGCCATTCAAACACACCAGCCGACCCGAGCCGAGCTGATCCGGTTCAGCATTTGCAGAATC
          CCTGCAAACAGCGTTTCCAGCCACCGTCTATGCAAGTGAGCAGCGACGTCTTTGCACATCCACCGCCAGCAGTTCGTCCA
          CCGCCTCACTACGCCGACAACGTGAGCATCAACGCCAGTCTAGACGGCATGAAGAGCTCCTCCTCCTCGAACAGCCTGGA
          CAGGTATCTGGGCGCTCCGCCCTCTGTGGCCTTGGCGGGTCCCAGCTTCGCCACCAGCGTCTTGGTCAGCAGCAAGGGCT
          CCAAGTACGAGATTAGCGGACCAGTCAACTTCCAGCACGTTTCCGGCGATGTGACGCGGGATCGCACGCGAAACGCCTTC
          GACCTGAATGCCGATCCCAACGACAAGGTGCTGAGGAAGTACATGATGGAGCGTGGCATTACGGAGGCGGACATTAGTGA
          CATGCGGCGCCAAGAAGTGATCAAGAAGATCATTCACTCCAATTTTACTTGGATGCCACCAAAAAGTGATCTTCAGGCGC
          AGCCAAAAGTTCAAGATCATGCCAGGCCGCTGCTCTATGCCACCATTTCCACTAATAACCAGATTACTCCTCCGCCGTCT
          CCACCGCCGCCTCCAATAGCCACTATTTCGAGGCCAACGGAGGCACCAAACTTCTCCAACTACGCCTCGCTTACTTCACG
          GTTTGTGGATATCTCCGATATGGACTTACCTGCTCCTACGCCGGCTGCACCAACTCCTTTTCAACCGGCAGAGGTCGGAA
          GTGTGATACCCGTCCAAGTGCAGCCTCAGCAGAGTGTGAAACCTAAGGTTCCTCCACCTCCATCGGCGGTAATGGCGAAG
          AACACACATGGATATCCAGCGGCCATTGACATTCGTCAAGTGAGGCCATCTGTGGCGCCAAAGGTAGCGAATGAGACGTA
          CGCCACCATATCACCGCAACGGAAAGTGGGCTCAATGCGCGTTCCACCGCCGGCGCCTCCAAAGCCAACAATAGTGCCTC
          ATACGAACTCGACGATTTCCAACGGATCACTGTATGCTGTGTCCCCGGTGCAGTACGCGCCTGTTGCCAAGCCGGCGCCA
          CCAGCTGCTCCTGCCAAGCCGACTTCTAGATCTTCGGCTGTCTATATGACACCACTGTCAGCGCAGAAAACCCAGATTAG
          TAGTACTCCGGTGCCAGTTTCACCACCGCCGCCTACAGCGGCATCCGTTGGTGTTCCACCGCCGCCTCCAGCGCCACCAG
          CAGGTGTTCCACCAGCACCGCCACCAATGCCAGTTTTTGGCGCGGGAGGCGCTCCTCCTCCACCACCGCCTCCATCAAGT
          GGCATGGCCGGCGTTCCACCACCGCCTCCGATGCAGAAATCACAGCCCAAGGCTGTTTCAGCTGCCTCCACCGGCGGAGA
          CCCGAGGGATGCGTTCTTGGAGAGCATTCGACAAGGCGTAAAGCTGAAGAAAGTGGATCAGAAGGCAGCCACCATAAGTG
          GCATTAAGCCGCGTCCAGAACGTAAGCCGGTGACCACCGACTTTCTAAGTGAACTGAAGCTGGGAATAACACTGAGACGG
          GTCAAGAATCCGGCGGATAATCCGTATTCCGAGGAATCGGAGTCGCAGGCGTAACGATTTGGCGGTTAAACTTTCAACTG
          CGCCGCATTTTACCACACTGAACCAAGTGGCAGGGCTGCCAGACTGAGAACAACCGCCTTAATTTTAATTTTCGCAAATG
          TATTTATAATTTTAATATTAATCACCATGACAAATGACCATTAGCGTTTGTAAATAAAATTGTTATCGCCAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082159
          1841
          FBtr0110789
          2175
          FBtr0334688
          2073
          FBtr0334689
          2082
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306745
          514
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081637
          514
          FBpp0110086
          630
          FBpp0306746
          596
          FBpp0306747
          596
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Whamy-RC
          Secondary FlyBase IDs
            References (0)