General Information
Symbol
Dmel\pnt-RE
Species
D. melanogaster
Annotation Symbol
CG17077-RE
FlyBase ID
FBtr0334554
Feature type
Associated gene
Evidence Rank
Length (nt)
3715
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    AAAAAAAAAAAAAATAGAAATAAATGTGAATTTAAGGAACGAAAGAAGAAAAACAACAACACCAAACATACTGATTGTCG
    CGCGGGGAATGAAAACAATGTACATATAGTTACGATATGCGCATTAATTTATCGCCCGTGCCAGAGCGACGATCGTGAAG
    TGCTCACAATTAATTGCCATTAATTCGCAAAAGTGCTAAGAATTCGCGACGGTGTGTGAACTGCGAATGCTGCAAATTAC
    GTGTATCTGAACAAGTGCGATCGTAAATACACACATACTTATTAAAAAAAAAATCCCGCTAGCTAAGCAGGGATTTGGTA
    ATATCACACCCTCATACCTCAAAACTTATCAATTGTCCAGCGGGCCATCCAATTGATTAGAACCCGCATCCACAAAAAAA
    AAAAAAAACCGAAAGCAAACCAAATTCATAAACCACACAAAAACGACCAAACCACATATATGCATTTACTGACAGTGCAA
    AAATTAAAATATACCCCCAAATATCAAACAAAACCCGAGAAACGAAAGTGAAGTGAAATCAATTTTAATACAACTGCAAG
    TACCACCAGCATAAGGGGACAATCCATTCTAATCAATTGAGAGCTGATCCCGCAGATTTGCCTAGTTCAGAGTCAATGAC
    GTGCACTTTGACCAGCGAGGTGGAGTTTCCGTTTTTGAGTACCGATCATTTTGAAGCGAAGAAATGCCGCCCTCTGCGTT
    TTTAGTGAATGCCAGCATAATCAGTGCCGCCAACGCCTTGGACAGCGATAAGGAGCAGCAGCTTCAGGAGCATCTCAATC
    AGAGTCACTTCACCAGCAGCAGCAGCAGCAGCAACAGCAGCAACAATAACAATTGCCACACGGCGCCCAACTACAACATG
    GTCCTGCAAAGCTATGAGAACTATCCCAGCTACCACCTGGCTCAGCATCATCATCATCATCATCATCACCACAGCCATCC
    GCATCACCAATTGGCGCAGCAGACAGGGCTGCACAGCCATCATACGATGCAACAGCAGCTGCAGCAGCAGCAGCAATCCC
    TACTCCTGCAACACCCGCAACAACAGCAGCAGCAGCACAGCCACCAGTCGCAACAGCAGCAGCAACACGGATACGGATCA
    TCAGCCCAGCTGCCCCATCATCGTTTATCCGGCGGCAGTACGGGCAGCACCACCACCACCTCCTCCGGCTCCAGTTCGAG
    TGGCTCCTCGTCGAGTGCCTCATCGCAGGGATTCGCCAACGGGAGCGCGACTGCGAACAATCTGGTGGGGGCGTTGAGCA
    GCTCCACGGCTGCTTCGCTGGGACTGGGCTACTTCAATGATATGGCGCCCTTTGTGGGCGATGCGAATGCCTACTACACG
    GACTCGGATGTCAACTTCTTTAGTTCAGGTACAGGCTACAACACCAGCAACACACACGACCGCATCAACAACAGCACGCC
    CCCGCAGCAGCAGCAATCGCAGCAGCCGACTGTCAATGGCAGCGGTAGCGCCAGCAGCAACAACAATAACTCCATGCTAC
    CGCCCGCTGTACAGCAAAGCAACAACGAAAATAACAACACCAGCAGCAGCAACACAAACAACAGCAGCAACAACAACAAC
    AACAGCGGTGGCAGCAACAATTCGAATGCGGGCAGCAATAACAACAATAATAACAACAATAATATTAACTTTATGGCAGC
    GGCGGCGATCTTCCAACATCACCTCAAAGAGGAGCCGGGCACCCAGAATGGTAATATCGGTGGCTATGGTGGTGGCAGTA
    ATAGCCAGAACGATCCCACGGATCTCAGTAGTTATGGATTGCCCGCCCACCTGGCCGCTTACGGTGGTGGGAGTGGCAGT
    GGGCCAACCGGCGGCAGGAGCTCCGGTGGCGGTGGCGATGAAAGCGATTATCACAGCACGATCTCGGCGCAGGATCACCA
    GAGTCAGCAATCGAGTGGAGGAAATGGCAGTGGAGGAGCCAGCGGTGGAAGCACCGGAAACAGCAACGGTTACTTGGACA
    GCAGCTCGGAGTTCTATGGCAGTTACGCGGGCAGGAATCGATTCCACGATGGTTATCCACCGGAATTTACGCCCTATGAT
    GCTCAATCCTTCCAGTCGATGGGCCCCCAGCCCACGGCCATGGATCAGTGGGGAGCAGCCCATGCCCACCAGCATCCGGC
    AGCGTATATGAGCACCTTGGGTCTGGATAAGGGCCTGCTGGGTGGCTATACGACGCAGGGCGGAGTGCCGTGCTTCACGG
    GATCGGGTCCCATTCAACTGTGGCAATTCCTGCTCGAATTGCTGCTGGACAAGACGTGTCAGAGTTTCATTTCGTGGACC
    GGCGATGGCTGGGAGTTCAAGCTAACAGATCCTGATGAGGTGGCTCGTCGTTGGGGAATTCGCAAAAACAAACCGAAGAT
    GAACTACGAGAAGCTGAGTCGCGGTCTGCGCTACTATTATGACAAAAACATCATCCACAAGACGGCAGGCAAACGATATG
    TCTACCGCTTTGTCTGTGATCTCCAGAATCTAGTTGGGCACACACCCGAGGAGCTGGTGGCCAAGTATGATCTTAAGATT
    GAGAAAAAAGATGTGGATTAGCAGCGGAGCAGCGGAGAAGCTGCCTAAAACGGGAACAGCTCCAGGAGATCTGCGCCCAG
    CCACGGATTGTACTCAACCAACCGCAAAATACTTTCGAGCGTTATTGTTTACCAAGCGTGATGTTAGCTTTTAAGCAGCT
    ACCCCCGATCTGCGATCTTGCAACGAGATTAAAGTGTTGGCCAACCCCTAAGTACCCAAAGTCCTGACTCCCCCCCCCCC
    CACACACACAAAAAACACAAACAAAAAGAAAACCCCCCACCCACCAACCTGTCAAACCGATTTGCTTGTAATTACCGTGT
    AAAAATTAGACTTTTAAATTAATTTGAAATTAATTTAAAATACATCAGATTTAGTTGTAAGCCGATCTATAGCAAGAGAA
    CCAGTTGAAGATAAACCGAATTAAATTTGAAATTCTGTGTGCAATGCGATGATATTTCTTCGTTCTCACATAGTCTGTAG
    AAGATGTCAGCTGCAAGGATCGAACGTTGATAGAGGCCATAAAGCATGTGTCCCCCAAAAGTGATATTAGAGCGCAACAT
    TTTGTTATACGTACATAATCATTTTACCCGCACGGGGCACCACAAACATTTCAAAATCATGCATGTATATAGCGTTGAAG
    ATGTGAATGGCATATAAGTAGGTCTCTAGTATTTATGTATGTCTAAATTGTAATCTGTGCTACTGGTACAACTAAGTTTT
    CCACTCCACAAAAAGCCCCTTTTATTTCTGTACTTCTGTGCGCTTCCGTGCGATCCCAAAAGTTTTAAACGTAAAACGGC
    ACAATAGCTTATCATGTATGTACATATATGATGAGCCCTTGTTATCGTCTGCTATCTGTATACTTATAGGCTAATCCTAG
    ATACATAGGATCCATAGTTTCCCTAGTGCGTTAATCGACAGTTCAAGAAGTGTTTATTACCTAGTATGTGTGTGTATAGC
    TATTAACTACTTAAGTCTAGCTCGTAGATGCATAGCCACGTATTACACCCATAAATATAACGTTATATTGATTACATAGA
    TACACATACATTTGTAGAGCAATTCTAAAATATTGTATTTATACAAGCGTACATCGTAATATTAAAGCTAAAATTAACAT
    TGCTAAGATAAAAACAATAAAAGAAAGCCAATATG
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0089717
    4074
    FBtr0089715
    2996
    FBtr0089716
    2805
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0306621
    625
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0088658
    718
    FBpp0088656
    623
    FBpp0088657
    636
    Comments
    Transcript terminates at site supported by polyadenylated cDNA.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    pnt-RE
    Secondary FlyBase IDs
      References (0)