General Information
Symbol
Dmel\Gcn2-RB
Species
D. melanogaster
Annotation Symbol
CG1609-RB
FlyBase ID
FBtr0334551
Feature type
Associated gene
Evidence Rank
Length (nt)
5284
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACACTTGTGCACCACTAGCCTTCAGTACAAAATACGCAAAAAATTTTCTTTTTCCGGAAAATTAAGTGGAAAGCGCAACA
      GGTTGTTCTCTTTACGCAACAAAAACGGCAGGAGTTCGCGTAGTAACTCATTTCACATCGAATTCAAGTCGAATACAGCA
      GCAAAGTAATGCAGCACGCAGCTGATTTGGAAACAGCTGCCAGCGCAGTTTGTGAAATTGCACACCGGCTAAAATAACCC
      GGTGGGAAATCCGAAGGAACTTCCGATCCAGTATTCCAAAGCACCCAGATGTAGCCAAGACTTATCCACTAACCGGAGAT
      TTAATGCAGAAATGGCGGATGAAAAGGCCAAGGAATCCTTCCGCGAGCGGCAAGCGCAGGAGTTGGAGGTTATAAAGTCC
      ATCTTTGGCTGTGATGTGGAGGACCTAAGACCCCAGGCGAATCCTTCCCTGTGGAAGCCAACGGACATACGGATACAACT
      TACCCCACTTCGAGACTCCTCGAACGGACTGGAAACCTATGTGTGCACCAAGCTGCACGTCACCTGTCCATCAAAGTATC
      CAAAATTGCCCCCTAAGATATCTCTGGAGGAGTCCAAAGGCATGTCGGATCAGCTGCTGGAGGCCCTACGCAACCAATTG
      CAGGCTCAATCCCAAGAGCTACGTGGCGAAGTGATGATTTATGAATTGGCCCAGACCGTTCAGGCCTTTCTCCTCGAACA
      CAACAAACCACCAAAGGGATCATTCTACGACCAGATGCTCCAGGATAAACAGAAGCGCGACCAGGAGCTACAGGACATAC
      AGCGGCAGCGGGAGTCCCTGCAACGCCAGACGCTCATCGACGAGGTGGAGCGGCGCAAAGAGATGTTCAAAACGGAGGCT
      AAGAGGCGCGGCGAACCAAGGCGCAGCATGAGCGAGTCTAACCCACGGCATCCTAGCTCGTCGGAGAGCTCCGAGAACTC
      CTCGCCCTACTATCGTGGTCACATCTACCCCTCCAAATGCCTGGATCACCGCAACACGGAGACGCTCTACTTCCACAAGA
      TGGGCAGGCAGATTCAGCGTGGATGCTGCGTTGGTCACTCCCAACGAGGTTGCATCGCCTACACTGGCATAGATATGCAC
      TGCGGCCAGTTGCTCTACATAACAGAATGGAACATCAAGTACAGCCAACTGGAGCAGCCATGCATCGGCGGAGGCAAGTG
      CCACTGGAGCAGCGAGTCAAAGTGCATGGGCAGTCATCGTGTGGACGAAGTGATGGCCTCCATTGAAAAGCAGGTGTCCT
      CACTGTCCCAACTACAGCACAAAAACCTCGTCTCGTACGAGTGCGTACTGTGCATCAAGCGAAAGGAAGGTCTACTTGTG
      TATTTGGTCCAAGACTTCCTCCTTGGCACCAGCGTGTTCAGCATCTCCTCCTCGCTTGGCTGGTGCATGGACGGCGCACG
      AATGGTTGCGCGCGGCGTGCTGGACGCCTTAGTATTTCTTCACAACAAGGGTGTATCCCATAGTCACCTGCTCGACACCA
      CTGTTTTTATGGACAACACAGGCAATGTGAGGGTATCAGACTTTTCGCTCGTTCCCAATCTTCTAGAACTTCTGAGCGGA
      GCTGGACAAAGCAGCAGTTGCGGGGACTTACCCGCGTTAGGTGCCCTGGTGGAGAGTTTGATGCCCACTAACAGTTACGA
      GATGCGCGACTTTGTAGACAAGTGTAACTCGGACCGAACTCTTTCCGCATCAGAGTTATTGGAGCATCCATTCTTACGCT
      TTTACGTCGACAATGGCCAGCAGCAGGTGATGCCATTACCACAGCAGCAACATCCTAACACCGTCCAGCGCACTGGATCC
      GCCATGCCGTACCAGATACCGACACTGGCCCTAAGCCAATCCCGCCTGCGAACGGAATTCGAGGTGCTCATGTACTTGGG
      AAAGGGTGCCTTTGGTGACGTGCTAAAGGTGCGCAACATTTTAGACAACCGAGAGTACGCCATCAAGCGCATACCATTGC
      CCGCGAGGAGTCGCCAGCTGTACAAAAAGATGACGCGCGAGGTGGAGCTTCTTTCGCGGCTGAATCATGAGAATGTAGTT
      CGATACTTTAACAGTTGGATAGAAAGTGTAGATGACGCAGATGCCGCTGAGATGGATAAGCTGCTGGGCGGTGAGTGGTC
      CCAGAGTCAGCAGGACCTTAGCGTAAAACCTGCCAAGTCACCACAGCTGGGGCCCACTTTAGAGGAGGACGAGGATGAAG
      AGGACAGCTCATCCAGCATGTGGAACGGTTACATACCCAACATGGAGGACTCTGATTCGGATGGCATTGAATTTGTGGAC
      TCCAACGGCAAGGTGGCTGTCTACGACGACGAAGAGCAGGAGGATTCCACCAGAGGCAAGACCAATTCGCCAAAACCTTT
      GATGCAGGTCATGTACATCCAGATGGAGTTCTGTGAGAAATGCACATTGCGCACCGCCATCGATGACAATCTCTTCAATG
      ACACGGATCGTCTGTGGCGCTTATTTCGGGAGATTGCCGAGGGTCTCGCGCATATTCACCAGCAAGGCATTATCCATCGG
      GACCTAAAGCCCGTTAACATCTTCTTGGACTCGCACGATCAGATTAAGATCGGTGACTTTGGTCTGGCCACCACCAGTTT
      TCTGGCTCTCCAAGCCCACGACGCAGCGCCTGCGCCTGTTAACCAGATAACCAGTGCGGAAGACGGCACTGGTACTGGTA
      AGGTCGGCACCACTCTATACGTGGCTCCCGAATTGACAGGAAATGCTTCCAAGTCTGTGTACAACCAGAAGGTTGATATG
      TACACCCTGGGAATCATTCTTTTCGAGATGTGCCAACCGCCGTTCGACACAAGCATGGAGCGGGCTCAGACCATTATGGC
      TCTCAGGAATGTTTCCATTAATATACCGGATGCTATGCTTAAGGATCCCAAGTATGAGAAGACGGTGAAGATGCTTCAGT
      GGCTTCTCAACCACGATCCCGCCCAGAGACCTACTGCCGAGGAGCTGCTCATCTCAGACCTGGTTCCACCAGCCCAGTTG
      GAGGCCAATGAGCTCCAAGAAATGCTGCGTCACGCCCTCGCTAATCCGCAGAGCAAGGCCTACAAGAACCTAGTTGCCCG
      ATGTCTTCAGCAGGAGAGCGACGAGGTGCTGGAACACACCTACCACTTGGGAAGCAGTCGAGCTATGAAATCCTGGAACT
      CGGCAATTATAATCGATGATATAGTATCCCTGAACCCAGTGATTGAGTTTGTTAAGGCTAAGGTCGTGAATTTATTCCGC
      AAGCATGGAGCTATAGAGGTGGACTCACCGCTCTTATCCCCACTTTCCGCAAGGAACAGCACTGCGAATGCGAACGCCAA
      TGCCGTACACCTTATGACCCACTCGGGATGTGTGGTGGTGCTACCCTGTGACCTGCGGACTCAGTTTGCGCGTCACGTTA
      CCATGAACAGCGTGAATCTCATCCGGCGCTACTGTGTGGACCGTGTCTATCGGGAGGAGCGAGTGTTTAATTTTCATCCC
      AAGCAAAGCTACGACTGCTCTTTCGATATAATTGCACCCACAACTGGAAGTCATTTAGTTGATGCCGAGCTGCTGTCGTT
      GGCTTTTGAAATCACCAGTGAACTGCCCCGATTACGCGAAAAGAATTTGGCGATCCGCATGAACCACACTAATCTCTTGA
      GGGCCATCCTCATCTTCTGCAATGTACCAAAGGCTCAGTATGGAGCACTCTTCGAGGGCACCATGGACTTCATCGAGTCG
      CGCATCTCACGCTTCCAATTTCACTCGAGTATTACCGGGATTATGGAAAAGTCGCGAACATCTGCTCAAACTCTGATGGA
      CATGTTGTTAGCTAACTTTCTGCTGACTGGTTCCAGAAGCACTGTGGACGATTCCGCGCTGAAATCTTTGATGCGTGGAA
      AGGGAGAAGCAGCTTCACTGGCAAGGGGAGCATTGCGGGAACTTGAAACAGTTGTGGGACTGGCTTACAGTCTAGGCGTA
      AAGTGTCCTATACACATATGGGCTGGCTTGCCCATCAGCTTCGATCGTGCCAGCAACGGTGGAATTGTGTGGCAGATGAC
      CGCTGACCTGAAGCCCAATCGCTCTGGCCATCCTTCGGTTCTGGCGATTGGGGAGAGATACGACTCTATGCTGCATGAAT
      TCCAGAAGCAGGCGCAGAAGTTTAATCCCGCCATGCCAGCACGTGGAGTTCTTAGTGGAGCGGGCTTGACGTTCTCCCTA
      GACAAGCTGGTAGCTGCTGTTGGTGTGGAATACGCTAAGGATTGTCGGGCGATAGATGTGGGCATTTGCGTGTGTGGAAC
      CCGTCCACCGCTAAAGGATGTGACCTATATCATGCGTCTGCTGTGGTCGGTTGGCATCCGATGTGGAATTGTGGAGGCCG
      CCAGCGAATTGGGAGATGAAGCACAGGATCTTGCCCGCCTTGGGGCGTTACATGTCATCCTGGTGGCGGAAAATGGCTCA
      TTGAGAGTGAGATCTTTCGAGAGGGAACGATTCCAGGAGCGTCACCTAACAAGAACCGAACTGGTGGAGTTCATCCAGAA
      GATGCTGCGAAGTGATGGACTCAATGGGACCACCGTGGACAACTTCAGCCAGTTGTCAGCCTTGGGTAGTGGTGACAACA
      GAAGCAGTGGTGGAAAGGAAAGAGAACGCGGCGAGAATGGTCTGAGCACCTCCGCATCGAATGCCACCATCAAGAACAAC
      TATAGCCAGTTGCCGAATCTTCAGGTGACGTTTCTCACCCACGACAAGCCAACGGCGAACTACAAAAGGCGGCTAGAGAA
      CCAGGTGGCGCAGCAGATGAGCTCAACGCTATCGCAGTTCCTCAAGAAGGAGACCTTTGTGGTCCTGGTGGTGGAGTTGC
      CGCCTGCTGTTGTAAATGCCATTGTGGGGGCCATTAATCCACGGGAAATACGCAAGCGAGAGACTGAACCGGAAATCAAC
      TATGTGATCGAGCGATTTTCGAAATACAAGCGCTACATCTCCGAGATAAACGAAGAGGTTGTCGACTATCTGAGCGATGC
      CAAGACTCCCATTGTGGCCTTGTACAGCATATCCGATTCCTACTACCGCGTCATCATCTAGCCAACATCAAATGCATAGA
      ATCGGCTGAACTACTTAGTAGACCAGCCAGTAGTGTAAGCTCGAAAGTGTCACAAATTATTTTCGCCGAAATTCTACTTA
      ACTGGCTGCCCTCCGTGCCATTAACACTTTTGTTTGTTTGTGCGAATCAAAATTGATGAGATTGTATGTTTCTGTATCCA
      TTTC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085787
      5737
      FBtr0334552
      5290
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306618
      1589
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0085148
      1589
      FBpp0306619
      1591
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Gcn2-RB
      Secondary FlyBase IDs
        References (0)