General Information
Symbol
Dmel\f-cup-RI
Species
D. melanogaster
Annotation Symbol
CG9611-RI
FlyBase ID
FBtr0334529
Feature type
Associated gene
Evidence Rank
Length (nt)
3319
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGCTGACTGCTGACAGTGAGCCAAAATAAAACGACGCAAAATCTGGACAAAACCGAATTCACCTGTGATTCGGCCGCTTT
          TTAGCGTCCCACTGACCTCATTTATCCTGTCATCCCTGCCAGCTTAAGCAACGTAGAACTTGGCTCATTCCGCGGTGCCC
          AGGAATGTGACCAGGCATCCGCATTTGGCGGCGACTTCGACTTTGGCCATTCCTGCTTCACCCACTACGGCTGTCCAAGC
          GACATGAGTGACAAAACCGGCCGAGGACGGAGTAACCCCTCCACCAGCCGGATTCCTCGCAGCGCACAAAGTCCGCGCCA
          AGCCTCAGTGGTCCACTCGCCCAGGACAAACTGTGCCTTTCGCCCGATTTTTCACGAGAGGAGCACTCACGAGGACGACC
          AGGTGCTCACCCAAGAACTATGGAAGCTGGCGCGTAAATCGGGCACCCTGAATCTTTCCAACAAAGCATTGGCCAGAGTG
          GTGACCCAGGAGCAGCTGCGTCGTTGGAAGTCCATGGTCCCACCAAAAACAAGTCAGCCGGTCAGTGATCAATGGAGCCC
          CGGCCTCGTTGACAGCAGCGCCTTGTGGTTCCAGTTCATGTGAGGCAAAAGCGATTTCGATCTCGAACTTGACCCTGGAG
          AATCCCAAAAATGGAGCGAAGCATATTTGCCGCTTCACTGACCAGTATGCGGGGCTCGTAATGATCCATAAAGGTGCTCC
          AGGGGTGCGTCCCCAGATCAGTCATCGCTTGATTCAGTCTACCCACTGAGCTGAGCGCCATCGGTTGTGTGACTCTACCG
          AAGCATCTCCCAAGATTGCGTCCTCCAGGAAACAGCTCACTTCGTTCTGCATGTGCGGTCCTTATCCGCGGAGGCGTCGC
          TACTACCAGATTCGCGAATTCCAGATGGCCTCCTCGGCGGACGAGCTGGAAAGCGAGGATCCGGACGATGAGCTGGAACT
          GGACGATTCCGAACCTCCAACCCGCGCTGAAGACTTGCCCAAGCGACTGTACGACATTAACGAGGCGGATGCGGACAGCA
          AGGCCGTAAATCTAGAGCAGCTAACGATTAAAGAGGAGGATGCCTGGTGGAACCAAGTGCCATTGAACAACCTGGACCTG
          AGCTCAAACACCTTAACGCACATATCGCCAAAGATCGAGAATCTGCAATCACTTACCGTGCTTACGCTGCACGATAATGC
          TTTGGTGGAGTTACCACCGGAGATCGGCAAGCTGGAAAAGCTAGTGCGCCTTAATGTGAGCCACAACAAACTCAGCCAGC
          TGCCGCGTGCGATGTACAGTCTACCGGAGCTGCGGCACCTCAACATCTCGTACAACGAGTTCGTCGAACTTAATCCGGAC
          ATCAGTGACCTTCACATGCTTGAGTTTTTGGACGGTGGGCATAACAATATTCAATCCCTGCCCGGTGGCATTGGGTTCCT
          GGTGCGTCTAACTGCGCTCTTGTTGCCCTATAATCACATCAAGGAACTGCCGCCCGATCTTGTTAACATGCGCTCTTTGC
          AAAAGATTGATCTGATGCATAATGATCTGACCAGCTTGCCGGAGGATATGGGCCTTTTGAGAAAGCTGGATTGCCTTTAT
          CTGCAGCATAACGACATACTGGAACTGCCCGAGTTCGAGGGAAACGAGGCCTTGAACGAGCTACATGCCAGCAATAATTT
          CATCAAGATCATACCAAAAGCTATGTGTAGTAACTTGCCACACCTGAAGATACTGGATTTGCGGGACAATAAGATCACGG
          AGCTGCCCGACGAGCTGTGCCTGCTGCGCAATCTAAACCGTCTCGATGTGTCCAATAATACGATCAGCGTGCTGCCAGTC
          ACATTGTCCTCCTTGGCTCATCTGATTAGCCTGCAGGTGGAGGGAAATCCCATAAAGACAATCAGACGCGACATCCTACA
          GTGTGGAACAACGAGGATCTTAAAGACTCTGCACGATAGAGCTGTGGCGAAGGCCAAGGAGGAGGGAGGTGGCGTCGACG
          ACGCTTCCACGTCAGCGGGCATCAGTGTTACCCGTTTGCGTGGTGGCCAAATGGACGATGGTGATATACCCGGAAACTTT
          CCGGATAGCTTTCACCACCAGCAACAGCAGAACGGATTCCAATGTCCTTGTTCATATCCATGTCAGCAGCAGCAAATGCA
          GCAGCAGTTTTGTGTGTATGAGCCGCTCAGAAACTGTCAGGAATATGATCGCCAGACCCAAGGGCGCATATATGAGCCCG
          AAAACTACCAACAGCAACATCAGAATGGCAGCTTGAGATCACTTTTTGTGCAACAGCAGCAGCAGCGAATGGAGTATCCC
          TATCCAGGATACTTTATGTACCAACAGCAGCAGCAACAGCAGTTCTCCTATGAGCAAGATCCATCCTCTCGCTCAGCTGT
          CCATCCACGTTGGGTGTAGTATACAAACTACGACATACACGTACATTAGCTGTCAATCTGGAGGAGCTCACGTCAGTGCC
          TGACCAGGTGTTCCAGATCGCCAGGGATGAGGGTGTGCATGTGGTGGACTTTGCGCGCAACCAGCTGAGCACTTTGCCCA
          ATGGACTGCAGCACATGAAAGATTTAGTTACGGAACTAGTTTTATCCAACAATGTCATCGGCTATGTGCCACAGTTCATC
          TCCCAGTTTACACGTATATCTTTCTTGAATTTGTCCAACAATCTGTTGAATGACCTGCCCACGGAGTTTGGTGTCTTGAA
          TACACTGCGTGAACTAAACATTGCAAACAATCGCTTTCCGTGTATTCCCAACTGTGTGTACGAGCTGCAAGGCCTGGAGA
          TCCTCATTGCCAGTGAGAACCACATAAAAATGTTAAATGTATCGGGTCTGCAGAACATGCGACGTTTGAGCACATTGGAT
          TTGCGCAATAACGACATCGAGACAGTGCCACCAATTTTGGGGAACCTGACAAACATAACTCACTTGGAGCTGGTGGGCAA
          TCCATTTCGACAGCCCCGCCACCAAATCCTGATGAAGGGCACTGACGCCATCATGTCGTATTTGCGCGATCGCATACCCA
          CATAGAAGAGCAATTCACACCGTTTTTTGAGAAACACTTCACTAGCAATATGTTTATTTTGAGGAATAGCGTAATGGAAA
          TTGATAGATCCGCTCGACCATGCCCACAAACAATCAATCTATGGATTGGCTGTTTGTGGACATGGATGAGGGGTGGCGTT
          ACAAGTACAACATACGACACACACCGTGCATCAACCAACCAAACTAGTCTGCATGCCACAATACCTAATGCACGTTGTTA
          ATCCTGGCTGAGTATCTGCAATAAATGGGAATAGTAGGG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082846
          2558
          FBtr0082847
          2470
          FBtr0112937
          3407
          FBtr0112938
          2532
          FBtr0112939
          2219
          FBtr0334526
          2885
          FBtr0334527
          2797
          FBtr0334528
          2795
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306596
          522
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0082311
          693
          FBpp0082312
          650
          FBpp0111850
          522
          FBpp0111851
          474
          FBpp0111852
          620
          FBpp0306593
          802
          FBpp0306594
          759
          FBpp0306595
          571
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          f-cup-RI
          Secondary FlyBase IDs
            References (0)