General Information
Symbol
Dmel\β-Spec-RC
Species
D. melanogaster
Annotation Symbol
CG5870-RC
FlyBase ID
FBtr0334405
Feature type
Associated gene
Evidence Rank
Length (nt)
7896
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 109 )
Sequence
CACTCGTTCGCAACGCGATGTTTTGAATACATACATTTTTTCCATTCTCGCCAAGTGAAGTTCATCCGCCAGACCGAAGA
TTTTTAGTTGAACGTGCTAAATCTATGAAATTAACTGTGTTTTATGAATCAATTAGGGCGAGCGGAGCTGCAAAATTATC
GAGTAGTGATTCTCTTCTGAAGGCAACACATTCGGTTTGGACTTGAAGGATTAACTCATAGGAACGACAAACGGAGAAGT
GGCGAGCTCCCGTGAAACGAAACGACAAAACCCAACATTAGAAACTCTAAGACGTATAAACTAGCAGCTATTAACTAACT
AATAAGCACGAAACCACTGTGGAAACCGTAGATCCCCAGCCATGACGACGGACATTTCGATTGTTCGCTGGGATCCCAGC
CAGGGTCCTGGCAACGAGTACATCGATGAGTACGAGTACGATGGCGGCAACTCCAGTTCCCGACTGTTCGAGCGGTCCAG
GATCAAGGCTCTGGCCGAGGAGCGTGAGAGTGTGCAAAAGAAGACATTCACCAAGTGGGTCAATTCGCATCTGTGCCGGG
TCAACTGCCGCATTGCCGATCTCTATGTGGATATGCGGGATGGCAAGCACCTGATCAAACTGCTGGAGGTCCTCTCCGGC
GAGCGACTGCCCAAGCCCACCAAGGGCAAGATGCGTATCCACTGCCTGGAGAACGTGGACAAGGCTCTGCAGTTCCTGCG
CGAACAGCGCGTTCATCTGGAGAATATTGGCTCCCATGACATAGTCGATGGCAATGCTTCCCTCAATTTGGGCCTGATTT
GGACCATCATCCTGCGCTTCCAGATCCAGGACATCACCATCGAGGAGGTGGACAACAAGGAGACCAAGTCCGCCAAGGAC
GCCCTGCTGCTCTGGTGCCAGATGAAGACTGCCGGCTATCACAATGTGAACGTGCGCAACTTCACCACCTCGTGGCGCGA
TGGCCTGGCCTTTAATGCCATCATCCACAAACACCGTCCGGATTTGGTTCAGTTCGAGAAACTCTCGAAGACGAACGCCA
TCCACAACCTAAACAATGCCTTCGACGTGGCCGAGGACAAACTGGGCCTGGCCAAGCTCCTTGATGCCGAGGATGTGTTC
GTCGAGCATCCGGACGAGAAGTCCATCATCACCTACGTGGTCACCTACTATCACTACTTTAGCAAACTCAAGCAGGAGAC
GGTGCAGGGCAAGCGTATCGGTAAGGTGGTCGGCATTGCCATGGAGAACGACAAAATGGTCCACGACTACGAGAACTTCA
CAAGCGATCTGCTCAAGTGGATCGAAACGACCATCCAGTCGCTGGGCGAGCGGGAGTTCGAAAACTCGCTGGCCGGCGTC
CAAGGGCAGTTGGCCCAGTTCTCCAACTACCGCACCATCGAGAAGCCGCCCAAGTTTGTGGAAAAGGGCAACCTCGAGGT
GCTCCTTTTCACCCTGCAGTCCAAGATGCGGGCCAACAACCAGAAGCCCTACACACCCAAAGAGGGCAAGATGATTTCGG
ACATCAACAAGGCCTGGGAGCGTCTGGAGAAGGCCGAGCACGAACGCGAATTGGCCCTGCGCGAGGAGCTCATCCGGCAG
GAGAAACTGGAGCAGCTAGCCGCCCGCTTCGACCGCAAGGCGTCCATGCGTGAGACCTGGCTGTCGGAGAATCAACGTCT
GGTCAGCCAGGATAACTTTGGTTTCGATCTGGCGGCCGTTGAGGCGGCGGCCAAGAAGCACGAAGCCATCGAAACCGACA
TCTTCGCCTACGAGGAGCGCGTCCAGGCCGTGGTTGCCGTTTGCGATGAACTGGAATCGGAGCGTTATCACGATGTGAAG
CGCATCCTTCTGCGCAAGGACAACGTTATGCGCTTGTGGACCTATTTGTTGGAGCTTCTGAGAGCGCGCCGCATGCGCCT
GGAGATCTCGTTGCAGCTGCAGCAGAACTTCCAGGAGATGCTGTACATCCTCGACAACATGGAGGAGATCAAGCAGCTGC
TGATGACCGACGATTATGGCAAGCATCTGATGGGCGTGGAGGATCTGCTGCAGAAGCACTCGCTTGTCGAAGCCGATATC
AATATCCTGGGCGAGCGCGTCAAGGTGGTTGTTCAGAACTCGCAGAAGTTCCTGAGCGACGACCCAGAGTCGTACAAACC
GTGCGATCCCGAGATCATTGTCTCGCGCGTCCAGCAACTGGAGGATGCTTACGCAGAGTTGGTCCGTTTGGCCGTGGAAC
GTCGCAGCCGCCTGGAGGAGAGCCGCAAACTCTGGCAGTTCTACTGGGACACCGCCGACGAGGAGAACTGGATCAAGGAG
AAGGAGCAGATCGTCTCCACCGACGAGGTGGGTCACGACCTGACCACCGTCAATCTGATGCTCAGCAAGCACAAGGCCCT
GGAGTCGGAGATCACGTCGCACGATCCCCAGCTGCAAAATGTGGCCAAGGTCGGTTCGGAGCTGATCACCGAGGGTCACT
TTGGTGCCGATCGCATCAAGGATCGATTGAAGGAGATCCTCAACAAGTGGGACCACCTTCTGGACCTCACCAAGTACCGC
CGCCAGCGCTTGGAGAATGCCGTCGAGTACTTCCAGCTGTTTGCCGATGCCGACGATGTGGACAACTGGATGTTGGACAC
CCTGCGCATTGTTTCCAGCGAGGATGTTGGTCGCGACGAGGCTAACGTACAGTCCCTCCTAAAGAAGCACAAGGACGTGG
CCGACGAGCTGAAGAATTACGCCGAAGTGATCGATGCCCTGCACAAACAGGCGGAGAGCCTGAAGCTAAACGAGGCGGAA
AAGGCCAATGTGGACAAACGCCTGGAGGCGATCGACAACAGGTACAAGGAGCTTACCGAACTGGCCAAGCTGCGCAAGCA
GCGACTGCTCGACGCCCTCAGCCTGTACAAGCTGATGTCCGAAGCGGATGGCGTGGAGCAATGGATCAAGGAGAAGACCA
AGATGCTGGACACGATGACTCCTGGCAAGGACATCGAGGATGTGGAGATCATGAAGCATCGCTTCGAGGGCTTCGACAAG
GAAATGAACGCCAATGCCTCGCGCGTGGCCGTCGTTAATCAGCTGGCCCGCCAGCTGCTCCACGTCGAGCATCCCAACTC
CGATGAGATTCTGGAGAGGCAGAACCACCTCAACCAGGAGTGGTCGACACTGCGCGAGAAGGCCGAGGCCAAGATGGATG
ATCTGAAGTCCGCCCATGGCGTCCAGACCTTCTACATTGAGTGCCGCGAGACCATTTCGTGGATTGAGGATAAGAAGCGC
ATCCTTACCGAGACCGACAGTCTGGAGATGGATCTGACCGGTGTGATGACCCTGCAGCGTCGCCTTAGCGGCATGGACCG
CGACTTGGCCGCCATTCAGGCCAAGCTCTCGAGCTTGGAGCGCGAAGCCAACAGCATCGAGGATGAGCATCCTGAGGAGG
CCAAGATCATCCGCGAGCGCATTGCCCAGATCGAGTTGATTTGGGAGCAGCTCACCCAGATGCTCAAGGAGCGCGACTCG
AAACTGGAGGAGGCCGGCGATCTGCATCGCTTCTTGCGCGATCTGGATCACTTCCAGACTTGGTTGACCAAGACCCAGAC
AGATGTAGCTTCCGAGGACACTCCCACTTCCCTGCCGGAGGCTGAGAAGCTTCTGAACCAGCATCAATCGATCCGCGAGG
AGATCGACAACTACACTGAGGACTACAAGAACATGATGGAGTACGGCGAGCGACTGACCTCCGAGGGAAGCACCTCAGAC
GATCCACAGTACATGTTCTTGAGGGAGCGCCTGAATGCCCTGAAGGATGGCTGGGAGGAGCTGCACCAGATGTGGGAGAA
CAGACAGGTGCTGTTGTCGCAGAGCTTGGACCAGCAACTGTTCAACCGCGATGCCCGCCAGACGGAGGTGTTGCTCAGCC
AACAGGAGCACTTCCTCAGCAAGGATGATACCCCCGTCAACCTGGAGCAGGCTGAGAACCAGTTGAAGCGCCACGAGGCC
TTCCTCACCACCATGGAAGCTAACGACGACAAGATCAACACCCTGCTGCAGGTGGCCGACACCCTGGTGGAAAAGGATCA
CTTCGATGCGGACAAGATTGGCAAGCGTGCGGAGAACATTACCGGACGTCGGGATGACAACCGTCAGCGTGCTCTGGACC
AACACGAGAAGCTGAAGAATCAGGTGAAACTGCACGAGTTCCTGCAGGATCTCGAAGAGCTGGCCGAGTGGGTGCAGGAG
AAATACGCCACTTCACAGGACGAGTCGTACAGGAGCGCAAAGACCATCCACTCCAAGTGGACGCGCCATCAGGCCTTCGA
GGCAGAGATTGCCGCCAACAAGGAGCGCCTATTCGAGGCAGAGAAGTCTGCCCAGGAGCTATCCAAGGAGAAGCCCGAGT
TCAAGGACGTCATCGAGCCCAAGCTTAAGGAGCTGGCGAAGCAATTCGACGACCTGGAGGTGCACACCAAGGAGAAGGGC
GCCATGCTGTTCGACGCCAACCGCGAGGTGCTTGTCCAGCAGACATGCGACGACATCGACTCCTACATCACCGACCTGGA
GAAGCAAATTGTCAGCGGAGACACTGCCAACGATCTGACATCCGTGAACATCCTGATGCAGAAGCAGCAGGTTATCCAGA
CCCAGATGGCGGTGAAGGCTCGCCAAGTGGAGGAGATCGACAAGCAGACCGAATACCTCCAGAAGACTGTGCCCGAGGAG
AAGATCGAACCGATTGTGGTGAAGAAGACGGCCGTGCTCGAGCGCTTTGAGAAGATCAAGGCGCCGCTTCTGGAGCGCCA
GAAGGCGCTGGAGAAGAAGAAGGAGGCCTTCCAGTTCTGTCGCGATGTCGAGGACGAGAAGCTCTGGATTGACGAGAAGC
TGCCGGTGGCCAACTCACCGGATTACGGCAACTCCCTGTTCAACGTACATGTGCTGAAGAAGAAGAACCAGTCGCTGGCC
ACAGAGATCGACAACCACGAGCCGCGCATCAATGCAATCTGCAACAATGGCCGCAAGCTGATCGACGAGGGCCACGAGGA
TGCCAAGAAGTTCGAGGCGCTGATCAGCGATCTGACCCAGAAGTGGCAGGAGCTGAAGGACGCCATCGAGAACCGACGGA
AGCATCTGCTGGAGTCGGAGAAGGTGCAGCAGTACTTCTTCGATGCCCAGGAGGCGGAGTCCTGGATGAGCGAGCAGGAG
CTCTACATGATGGTCGAGGATCGCGGCAAGGACGAGATCAGTGCCCAGAACCTGATGAAGAAGCACGAAAACCTGGAGCA
ATCCGTAGAGGACTACGCCAACACCATTCGCCAGCTCGGCGAGGTGGCGCGTCAGTTCAGCGGGGATGACATCTCCTCCG
GCGATGCCGTGGCCGTCAAGCAATCGCAGCTGGATAAGCTTTACGCTGGTCTCAAGGATCTGGCTGGGGAGAGGAGGGCT
CGCCTCAACGAGGCTCTGCAGCTGTTCATGCTGAGCCGCGAGGTCGATGATCTGGAGCAATGGATTACCGATCGCGAGGT
TGTCGCCGGTTCCCAGGAATTGGGCCAGGACTTTGACCACGTCACTCTGCTGTCGGAGCGCTTCAACGAGTTTGCCCGCG
ACACAGAGGCCGTTGGCGGCGAGCGAGTGGCCAAGGTGAACGGCATTGCCGATAATCTTATCCAGGCCGGACACTCTGAT
TCCGCCACGATTGCCGAATGGAAGGACAACCTCAACGAATCGTGGCAGGATCTGCTGGAGCTGATCGAGACACGCACTCA
GATGCTGGCCGCTTCTCGGGAGCTGCACAAATTCTTCCACGACTGCAAGGATGTGTTGGGACGCATCCTCGAGAAGCAGC
ACGGTGTGTCCGATGAACTGGGACGCGATGCCGGCTCCGTGTCGACGCTGCAGCGCAAGCACTACAACTTCCTGCAGGAC
CTCATCACCCTATACTCACAAGTCCAGCAGATCCAGGAGGAATCCGCCAAGCTGCAGGACGCCTATGCCGGTGATAAGGC
CAAGGAAATCACCAATCGCGAACAGGAGGTGCTCCATGCCTGGGACAACCTCCAGGCTATGTGCGATGCCCGCAAACAGA
AACTGGCCGACACAGGCGACTTATTCCGCTTCTTCAACATGGTGCGCATCCTGATGATCTGGATGGAGGACCTCGTCCGC
CAAATGAACACATCAGAGAAGCCGCGCGACGTGTCCGGCGTGGAGCTGCTGATGAACAACCACCAGAGCCTTAAGGCCGA
GATCGACACACGGGAGGACAACTTCGGTGCGTGCATCTCGCTGGGCAAGGAGCTGCTCACCCGCAACCACTACGCCTCCG
CCGATATCAAGGATCGCCTGATGACGCTGAGCAATAGCCGCAATGCCCTGCTCCGCCGCTGGGAGGAGCGCTGGGAGAAT
CTCCAGCTGATCCTGGAGGTGTACCAGTTCGCCAGAGACGCTGCCGTGGCCGAGGCCTGGCTGATCGCCCAGGAGCCTTA
CCTGCTCTCTTCGGAGCTGGGCCACACAATCGACGAGGTGGAGAACCTGATTAAGAAGCACGAGGCCTTTGAAAAGTCTG
CCGCCGCCCAAGAGGAGCGCTTCAGTGCTCTTGAGCGTTTGACAACATTTGAGCTTAAGGAAATGAAGAGGCGCCAGGAG
CTGGCGGAAGAGGCTGAGCGACAACGCATCAAGGAGGAGCAGGAGGCCAAGGCCGCCTCGGAGGCGGCGGAACAGGCTAA
ACGAGAGGCTGAGCGACGCGACGACGTGGATGTTGGTGCCTCGCACGACGATTCAGCCGCAGTGTCAAGACCCCAGTCAA
GATAGCACTCAAGATCCCGCTGCGAATTTAGTCTAACCAAAATATCTCTAAACGTTTTCTGTCATTCAATCATGCCTACT
TAACCAAACTCAAACCAATCTCATCCTGCCACGGATTAACCAACTAACCAATCAACTTAAACCCATGAAGCCGCCAAAGA
CACGGCCGTCGAGTTCGAGCGCGTTGTCGAGATCCAAACAGAACGAGGCGGAACCCCAGGCGCCGGCGAGGGTCACGAAG
GATATGTGACACGAAAGCACGAGTGGGACTCGACCACCAAGAAGGCCTCCAACCGATCTTGGGATAAGGTATACATGGCT
GCCAAGGCCGGACGCATTTCGTTCTACAAAGATCAGAAGGGTTATAAGAGTAATCCCGAATTGACCTTCCGCGGTGAGCC
CAGCTACGATCTGCAAAACGCTGCCATCGAAATTGCCAGTGATTACACCAAGAAGAAGCACGTTCTGCGAGTCAAGCTCG
CCAACGGTGCCTTGTTCTTGCTGCAGGCCCATGACGACACCGAGATGTCCCAGTGGGTGACCTCCCTGAAAGCCCAGAGC
GATTCGACAGCGGTGGCCGCCAGCAGATCCCAGACTCTGCCCGCCACCTCACAAAAGGACGAACCAAAGCGCAGATCGTT
TTTTACTTTAAAGAAAAAGTAAAGTAACAGCCGTAACGCAACCATAAGCAAGAGCAGCTAATTAAAACAAATAACAAATA
ACATGAAATGATATAATACAAATGCAAAACGACAACAAATTATACAGCAAAAATTAAGAAGAAGCAAATATATATATTTT
TTTTTCATATATTTAAAACTTATTTCGTAATGAGAAAAAAACAAAAACCGACAAAAACTTGCAAGAGAAGAACGAGCAAA
ACATAAACAATTATTATGCTTATCAAATTTGCACGATAAATACTGCTATTATGATTAAACGTATGTATCTTATTTATTTA
AACAAATACAAAGTAATATAAAGATTAAAAAAAAATACAAAAAACAAACAAAAAATTTGAGGAAACCAACTCGTGTATGC
ATTTCAATGTATTCGATAAATAAACGAAATATTCCTTTAAAGTACACCAATTGCCG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0074454
7671
FBtr0334404
7718
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0306508
2147
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0074228
2291
FBpp0306507
2308
Comments
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
β-Spec-RC
Secondary FlyBase IDs
    References (0)