General Information
Symbol
Dmel\CG44000-RB
Species
D. melanogaster
Annotation Symbol
CG44000-RB
FlyBase ID
FBtr0334119
Feature type
Associated gene
Evidence Rank
Length (nt)
2308
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGTGTTTGCTACGCGCCAGCCCTGACTTACATTACGAGGAATAAAAGAAAATAAATTGCACAAATTGGCGAAAAGCGCA
        TTATTGCTAAACTAAAGCCTCGTTAATTTAGCAGCTGACGACATCGAGCAGTTGAACAAGTTCTCCTGCGGCGGCTACAG
        CGACGAGTCCACCATCGTCTACTTAGTGCATCCTTGTCGGATTTTATCGGCGCTAGAAATCCTGGGATTTCGCGTAGTGG
        CCAGCTCATCGACTGCCGTGAAGCAGGACTACAACGAGTACATGTGGACGATGCGCAAGGAGTTCGACGAACCAGAACCC
        TTGGAAGCCGAGTCCGTGGTGCGAGAAAATCTATCGAATATTGGCCGCGAGGCAGCCAGTTTAGGCAACTATCACAAGGT
        GGATTCGCCTGAATAGACCCGCATCCCATCCAGTCCAAAACAAACAAAAAAAAAAAGAGCAGCAATCAACCAAGAACTCT
        ACTCTAGTTGTATAATTTAGTGTGTGTGTGTGTGAATTGTGTGCGTGTTTCGGTGTGAAAAAAGAAAAAAAAAAAATTAT
        AGTAACCTAGGGAATTTTGTTCCATAACATACACTGAGCAAAGGAGGCGACCAAGCGAGTCCCTTCAGACGAACGAACTA
        TGAGTGAGGGCGCAGTCGGGCTGAAGGAACCTCAGAATCTCAATAGCGAAGTTGTTTCGACTGTCGTGTCCGCGGCATCG
        GCTGCATCCTTGAACGCCGCCACCGCCAACGTACCGGCCAATGTGGTGACCATACCGGTGCCCATTCTGCAGTCGGAGGG
        CAACTTTGCCTACGTGACCGTCAAGGGCTCGCTGCACGATTACACCTGCACCATTTTTGGCCTGAATCAAGCGGAAGTTC
        AAGCCCTGTCCAAGCGCTTCGAGAGCGGTGTTAAGGCGTGCGTCAATGGTATTATGGTGGCAGTGCCGCCCATGGTTATG
        CTGAACACTCTCGCCCAGCTAAGCTACAAGGTTGTCTGCAGTTGCGGCGAAGCCGAAATTTGTTGGACCATGCAGCGTGA
        GGTCTAATTCGTTTGATGAGATCACACTGTTATAGCGTCAAAGATCAGGCAACTGGCAGCGAAAGCAAAAGAAGCGGAAA
        AGGAATTCGGAATTCGGAATTGTAGAGAATATCTCGAAATAATCGGCAAGCTAAGATGGATCCACATAGTGCGGACAACT
        GCAAGTGCCACAAGCAGACGCAGCCGGCACAGCAGACGTTAAGCGACATGGACTTCGATCGAGGCATTTGGAATGCAGCT
        ATCTATAACGAAGTGGAGCGTGTAAGAGAGTTTATCAAGAAGGGCCAGTCGATGGCTCGCGATGACTGCGACTATACGGC
        TCTGCACTATGCGGCCCGCAATGGGAACGAGCCCATCTGCAAGCTGCTTCTCGACGAGGGCAAGGCAGACGTGAATGCTG
        TGACCAAAGCAGGAGCCACCGCGCTGCATCGTGCAGCCATGATGGGCCACTTGGAAATCGTGAAGCTACTGGTCGAGCAC
        AAGGCTAATCTTCTGCTGCAGGACGAGAGCGGACAGACCGCTTTGCATCGAGCAGTGATGCGGGGCCACCTGGAGGTGTG
        TCGCATTCTGCTGGCAAAGGAGCCAACACTTAAGCTGGTCAAGGATAAAAAGGACAAAATTGCATTTGAGTACATCATGG
        AGAACGCCAATGATGATTTTAAGCTGCTGCTGAAGCCCTAAAGGGCTTGTCATTCCCCGTTCAACATATTCGTATTCGTT
        ACGGTTTAAATATCTTTGTTTATTGAGTCTGTTAACACGTTTTCTATAAAATTGCACCCGATATCGTTGTAAAATCCTAC
        TTAGAAATTGCATACGTCCTTATTTGTTTGCATTGTGTGCGAGATCGATTGTATATGGGAAAAGTAATCTTAACGTTTGC
        GTAGTCAAATTAACATAGTGGATACATACATCGTTTAAATCTTCTATATAGACTATATACACATGCCTAGTAAACATAAA
        ATGTGCAAGTAATTTAGTGAAAACTCTGTGCCCAACAGGATGTGCACACGGAACTCGTTTTGAAAAATGCGAGATTTGCG
        TGAAAATTCTGTTCAAAATTTGTAATACATCGTAAGAAAATTAATATCACATTGGAGTCCGTGTATCGAAGTTGTTAATT
        AATCTGGCGTTGAAATTGAAATTAAGGAAACTATTGCAGAACCTTCCTACACACTCGTCGCCAATTTACAAAAACTATAC
        GCTACCTATCATTATAGCAAACATATAAAACCTATATAATCTGAAAATAAAATTCCTAAAGCGCAATC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0334121
        2691
        FBtr0334120
        2281
        FBtr0334122
        2431
        FBtr0334123
        2415
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0306236
        135
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0306238
        135
        FBpp0306237
        135
        FBpp0306239
        135
        FBpp0306240
        135
        Comments
        Dicistronic transcript; alternative polycistronic transcript(s) exist.
        Transcript terminates at site supported by polyadenylated cDNA.
        transcript_exception: dicistronic_mRNA
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG44000-RB
        Secondary FlyBase IDs
          References (0)