General Information
Symbol
Dmel\Sfp78E-RB
Species
D. melanogaster
Annotation Symbol
CG42607-RB
FlyBase ID
FBtr0333971
Feature type
Associated gene
Evidence Rank
Length (nt)
805
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGCAGGGGTGTATCTTTGTTCTGTGGAACACACACATTACACATTAGGCTGATCCAATACATCAGCAGACTTGTTTGAA
          TCAATCAGTCATAGAGGAAAACTGCATCAGCAAGGTTGAGCTATGAATATCTTTATCTCCTTAATATTGGTAGTGCTGGC
          CATTTTATCTTTTGCTGACCACACCGTGGTAAGGGTAAATCCGTATATGGAGTATTATGGATCGTACATTTATTTTAAGG
          CAGACGGAGATCGGCACCTAAATGAGGACTTAAATCGAGCGACGGTAAAGAAGACTAAGTATGGTTGGCAATGTGCCGGG
          GTGACGTGCCCCATAAAGTTTACGGCATCTTGTAAGGTAACAAAGGTCCTAAAGCCCTCTGATCTACAGCACACTGAGCT
          CCTGATTTTGTGCATGGATAAAAACGATAAGCCTATGTGTGGGATAACACGAACTCGAAAAGGGGTAATACAGGAAGTTC
          TGGACGTGGATGAAAACGGAAATACGATATATGACAAAAAGGAAGTTATTTCGGAGAACGATGGTACTAAAATCCCTAGG
          TGCCCACGAAAGTAAATGATGTGCACTGATCGACTTCACACAAATATGTTTTATCTACACAAGGTTTTTAACTTTAAATG
          TTATGGACTATAAAAATAATTACACATTTTTGTGGCAACCAACAATGGTTTATATATCTTGTAGAAAAAATATTGGTATA
          GTTTGGCAATTAGTATGTATATAGAATTGGTGAAACTAACAGAATGCGTTACACATAAATAAAGATAACGAACACAAAAG
          ACAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0301939
          778
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306091
          150
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0291151
          133
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Sfp78E-RB
          Secondary FlyBase IDs
            References (0)