General Information
Symbol
Dmel\RhoGEF3-RH
Species
D. melanogaster
Annotation Symbol
CG43976-RH
FlyBase ID
FBtr0333958
Feature type
Associated gene
Evidence Rank
Length (nt)
3501
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 54 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Sequence
      CTGGTGGCGCGTGTGTGTATCTGTGTATACGTACTGCTGGCATTCTCGGGAACGCTTGGGCAGAAGCCAAAATGTGTGCC
      AGCGCATAGGGAACGAAAGAACGCAAATAGCGCATCTACATTAAGAAACAGGCAAAATCAATAACACCAAACCAAACCGA
      ACCGAACCAAAGCAAGCAAAGATTATTACGCAAAACGACGGGCGCATATGAAAATGTCTATAACGGGCGCAGATAGTGGG
      CGTGCTTCGGCCACCGAGCTCGAGGAGTCCGCCGTCGCGACGATGCAGCTCAGGGAACCCACCACACCCCCGCCACCCAT
      CAGCGGCGAGGACGTTTTCGCCAGCCGCGTCTCCCATACCACGTGGTACTTGCCAGTGGAGGACTCGTCCTCGCCGCCCG
      CATCAAGCACCAACGAAGCTCGTGGCGCGTCGCCTGACGCTGAGCCCCGGGAAGGGGATGCAGCTGGCGACTCGTCAATG
      AGCACCAGTGACGAAATGCCAAAACCTGGAAGCAATGAAATGGGAACAACCAGTGACTGCGCTGCGAGTTTGTCACAGCA
      AATAAAGGCGGTCTCCAGTCCAACGCTGTCCGAGCCGTGCTTAGAGGAGCAGCCACAAAAAGGAACTGAAAGTACGGATG
      TGGCCAACACAGGCAGCAGCGCCGGAAGTGGAGGCCTAGGCGTATTGCAGAAATTCAAACGCACCTTGAACAACTTTAAC
      AACAAAAATCAATTGCACATCTCTCCGCTATCACCAGCGGCAGTAGGTAACAATGCCCCAAAAACTAAGACATCGCCAAC
      AACAACAACCGCATCCATAGCACCTATGATAACGACGACCACAGCTAGCGATCCTGGCTCAGAGGCCGGCGATACGAGCT
      CAGGAAAATACCGGTTTGGGCCCCTTATTTGGCGTTCTTCCAAAGAACGCCGTAAGACGAAGTACAACCGACGCGACAAG
      TGTAATTCTGGTGATTCAGGCATACAGATCGAACTAGAACAGGATGAGCAATACTCCCGTGCGACAATGGCCGTGAGCCG
      CCAGGATGAGCCCCGCGCTTTTGCGTTAACCAATGGATCGTGTGGTGTCGCGCTCTCTAAAATGCGAGCCATACGTCGCA
      CCAACTCTGCAAAGGCGAGCAGCATCCTTGGGCCCTTTATTGTTAAAACCAAAATAGCCAAGCACTTAAACATTGGAGAG
      TCTGACAAAGCCGAGCGCAAAGCGCCCGAGTCTCTACCCACGCGATCGCTTAGCCAACCGAACGGCCTAGAGTCCTACGG
      TATGGGTCGTCCCGATCTTGAGGATAGCGACAGCGATAGTGTCGCGTCAAACGAGGAAGCTATAAGCTTCTACCCAACCA
      CCTATGCGGAGGTGCTTTACAACTTCACGGCCGGCGGTCCTCAAGAACTAGGGCTAGAGAGAGGAATGCTTATTGAAATA
      CTGCGCAAGGAAGTTGGACCCTGGTGGTTCGGCCGAATTAAGAAGGAGGAAACCAATCTGGTGGAAGACATATTGGGTCC
      TGAGCTGGGCTGGTTCCCCAAGGAGTTTGTGCGCATTATTCACTGTCCAGAGACGGACAATTTCTTTATAGCGCACAGGG
      CTGCCGCTGATGAGGCGGCGGCTGAGGAAGCCACTGCTCGTGCAGAGGAAGGGTCTGTTCCTGTTCCCGTTGCGGCATTT
      GCCGAGGACACAGACGTTACCGTCACCACAGACCAAAGCAACGTCACCCTTATAGTCATTGAATCACCACCAACTCCGAG
      TGCACCCAGTGTGGACTTTGTTGCCCAACCGGATCACAGCACGATCATACGCCGCAGTGCCGTTCGCGAACTGCTTGATA
      CGGAGGTCAATTATGTAAAGCTGCTAGCAGCCATTTGTGATGGTTACCTGCCAGCTATGAGCAAGCGAATCGATATATTT
      TCGCCAAACAGTATTCGGCTTATCTTCTCCAACATAACGGCCATTTATAAGTTTCAGCGAAAGTTTCTTGAAGCCTTACG
      ACGAGGCATCGAGCAAAACCAAGTTGCCAAAGTTTTCCTCAAAATGCACAAAGGTTTCCTTTGCTACTCCACCTATTGTA
      ACGCATACCCTCGAGCCCTGATAGAACTTGAGACCTACGATCGCGTAAAAGACGCCCGTACAATTCTTGAGAACTGTCGC
      GAATCCCAAAACCTGGCCGAGCTGCCCCTCTCTGCGCACCTGCTGGCACCTGTGCAACGAATCTGCCGCTATCCCCTGCA
      CCTCAACGAGATTATTAAGTCGGCATTGGAAAAGGGAGCCAAGGAAGGGAACGATACAGACGGTGCGAAGTCAGCTGGCA
      AGACAACTGACTATGAGCAACTCGATGTTACTGAACTAGACATACCCGACTCTCAAGATACTGTCAATTTGGCGCTGGAA
      GCGATGCGCGGCATCACAGAAGCAGTCAATGAGGGCAAGCGCCACAGCGAGACGATTGCAAGGCATCAAGCCAGCTTCCA
      AAACTTTAAGGGCCCGCCGCTGCACTTGCATAGTGCTCGCTTCTTCCTGCAAGTCGATGCCACGCGGCAGAAACAGAATC
      TGTGGAACAGCAGCTATACTCTGTTTCTTTTTGATAACCAGCTCGTTTACTGCAAGCGAGATATTATTAAGCGGAGCCAC
      TTCATCTACAAAGGACGCATTTTTCTCGATCGCTGTCGCGTGGTAAACGTGAGGGATGGAAAAATGTTTGGGCACACCAT
      TAAGAACTCCCTACGCATATATAGCGAGTCTCGAGACAAATGGTACGATTTTAGTTTCCGTTCGGCGAACCGCAAGCATC
      GCTTCCTAAGCACTCTCGCCCTGGAGCGCCAGTTTGGTGGTAAAGCTCTATACGTATCAGAGATGACTGGATTCGAGTAC
      AATTACGAGGAGCGGCCGGGCGATTACTCAGACCAATCAGATTACGATGCACAAGATTTTGAATTAGCAACTGGGGTCAC
      CAGTGGTGAGAGCTCACTGCCGGAGTCGCCGGCCAAATCTACGTCTCGCCTGTGTGAGACACTGCCAAAAAAATCTCAGT
      CCAGGGACGGAATATCCAGCGCTGAAAACTCTCAAATAGTCACTACCACATCGACAGGTTCGCTAGGAAGGCGGCATTTT
      GGCAATTGGTTCCGCAAGCCAAAGAGCGCAAACTGCACTCCAAGTCAATCACCGACGCATAAGCCAAGCTTCGACGCAGA
      CGCTACGCTCACGGAAGCCCGGGTTGCTGCGATGGAACTGGCTGAAGCCGCGGCCGCACTAGTGCCAACGGACAGCTCCT
      CAGCGTAAATACTAGGGACAGCTTTGTATCGAATCGCAATACAAATACAAACAGCGTAAAGCAAACATAAATTCGTGGTA
      GAACACACGATATAAAATATTTGTTACATTAATATTAAATTGTCTTAAATTATAGTAACATGTAGTTGACCAGTGTTACA
      CTTCGTAGATGTTTCGTTAGTTACCCTTGGGTTTTTGTTCAATATAAATGATTGTGTTTCT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0333952
      4541
      FBtr0333955
      3086
      FBtr0333954
      3153
      FBtr0333953
      3168
      FBtr0333956
      3564
      FBtr0333957
      3258
      FBtr0333959
      3082
      FBtr0333960
      3157
      FBtr0333961
      11114
      FBtr0333962
      12307
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306081
      1026
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0306075
      1011
      FBpp0306078
      932
      FBpp0306077
      925
      FBpp0306076
      930
      FBpp0306079
      1011
      FBpp0306080
      920
      FBpp0306082
      820
      FBpp0306083
      820
      FBpp0306084
      3519
      FBpp0306085
      3518
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG43976-RH
      RhoGEF3-RH
      Secondary FlyBase IDs
        References (0)