General Information
Symbol
Dmel\Syn1-RD
Species
D. melanogaster
Annotation Symbol
CG7152-RD
FlyBase ID
FBtr0333892
Feature type
Associated gene
Evidence Rank
Length (nt)
3741
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 10 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATACTGAATCTTACCCGCGTTGCTATTGGTTCCCTCTGCGAATATTTGAAAAATACAGCGGAAGTGGTCTATATCGGATA
          CATTGCGGGGTAAAACAACACGCATATCTTATTTAAAATAAAAGTGCGTTTTCGTACGTTTTTTTGCTTCGCGACTTACC
          AACGCCAACGAATTCAGCTTCCCGCTTTTCTAACGGCTTTTTACGGGCGCCGCCGTCGCCGCCAAACAAACAATAATAAT
          GAAAAGCGCCAGACAAAAAGCAAAGAACAAATTGGCCGACCAGTATTGTAGTAAGGCATTTGTTAATGTTAAGTGTTGAC
          TTGGGCCAACGTCGCATCGCGTAAATGTTTGCATGTCAATTGACCAGGTTTTCTGGACTCTGAAAAAAGGGTAGCCGCCG
          CGTAGTGTAATAAAATCAAAAAATAAAAAAAAAAATAAATAAAATAATAATAAAAAATAATAAAAGCAAAAAATACCTAA
          TACACACGCACGCACTGGATCACGGGAGCGCCACAGTGTGTGTCAGTGAGTGTAGGTGTGTGTTTACGCGCAGGCGCCAA
          TTCGAGTTTCTGAGCATTAATTGCTTTTCGCAAAGTACTTCGCAATACGATCGAATGACCTTTTCGGCGACTGCCATGTA
          GAATCACATAACAACAAAGTGCATTTAAAGTCAGAAAGGAATCATGGTGGAATCCTCGAGTCTGGGGAGGACCCCGCCGG
          CGGCCCAGCAGCCCATTCCGCAGCAGCACTCCCCTTCGCCATCAGGACTGCGATGCGGCAACATGGAGACGCGTGTTCGC
          GGCGCCTGGTACCGCGTCCTGGTCACGCTGGAAACGGACTTCCTGGCCGTCAGCCTGGACGAGTCCTGTGAGGCGGCGCA
          GCCATCGAACGATGGACAGTCTACTACCTTAAATGGAACCTTGGGAAGCAATCACAGTGGCGGAGGAGGCGGTGGCGCAG
          GCGGTGGTGGCACAGGTGGAGGTGGCCAGAACGGCACCCTGCCCAATTCCGCGTCGCTGCAGGGCATGAATATCCAGGAT
          ACAGAGCTAGACGGCTCCGCTAGCAACGACAATGGGGACCGCGATCCTTGCCTGAACAACAACAACAATGCTGGCGACGG
          TGGCGGAATGGATATGTGCGACGTACCTGACCATGTGGCCAACCAGAAGCGGCATGTGCGGATCATCAAGTCGGACAACA
          ACGGCCTGGGTATCTCCATCAAGGGCGGCCGGGAGAACCGCATGCCCATCCTCATCTCGAAGATCTTCCGGGGCATGGCC
          GCCGACCAGGCCAAGGGACTCTACGTCGGCGACGCCATCCTGACCGTCAACGGAGAGGAGTTACGTGACGCCACCCACGA
          CGAGGCGGTGAGGGCCCTCAAGCGGTCCGGTCGAGTGGTAGATCTGGAAGTTAAATTCCTGCGCGAAGTGACGCCCTACT
          TTCGGAAGGCAAGCATCATCTCGGAAGTGGGTTGGGAGCTCCAGCGGGCCTTCCTCTGTCCGCTGGGACCAGGCGTACCC
          ACGTCGCCGCCCGCCCCCAAGACGACACCCCGGGCGGATACGCGATACATCCCGCTGCAGCTGACGCATCTGGCCAGGAA
          TCTCAAATACATCGACCCGGAAAACCGGTGCTTCGAGTTGCATTCGCCCGACGGAGTGCACTCCTGCATCCTGCGGGCAG
          CGGACTCGGCGGAGGCCCTCGTCTGGTTCAATGCCCTCCACTCGGCGATGGGCACCAGCACGCAGCGCGCTTTGGCCGAG
          GCCAATCGGGCGCTTACCAACCTCATCGGCGAACTGAAGCACATTGGATGGCTGAGCAAGCGGATGAGCGGCGGAGGAAG
          TTCTGGTAGCGCCGGGGGCGGAGCGGCTAGCGGAGGCAGCGGCACCTCGAACAGCGTTGTAGCCGGCGAGTTGGTAAGTC
          CCAGCGGTCGTTCCAGTTCCGAGAGCTCCGATGAGAGTGACAAGTGGCTGCCCATATTCGTGGCGGTTACGGAGCGTGAG
          TTCCGGATATACGAGAGTGCTCCCTGGTCGGTGGAGGCCTGGAGTCGGCCCCTGGAAATCTACGCCCTGGCCACAACGCG
          CCTGGCAGGAGCCGGCAACAATTCCTCCCTGAACGGCCAGCAGACCACAGTGTTCTGCGTACGATGCGGCACCGCCCGCG
          GAGTGCTCGTCTATTGGCTTCGCTCAGAGACGCACCGGGACATGGCCGCCTGGGCCAGGTCTCTCGTCCAGGGCTCCCAC
          CAGGCGGTCAACTACCAGAGGGAGTTCTCCTTCCGCTGCCTGTTCCAGGGCCGGCAGTGTCAATTGGTTGTGCACATAAA
          CCGAGGCTTCTTTCTGTACGACTGCGGTGGATTCGCTCCAACCACTCCGACGGTAGCCACCGCCAAGACGCAGTTGTGGC
          AGTTCGCCTTCGACAAGCTGAAGGGTTCCGCCGATGACGGCGCCAGGATGTTGTATCTGGACTTTGGCGAGGATGGAGAG
          ATTGAACTGGACATGGAGTGTTGTCCCAAGCCGGTTGTCTTCGTCGTGCACAATTGCCTGTCGGCCAAAGTTCACAATAT
          CGCCTAGGACGAGGTTGAATTGGAAAGGTAGTCTGATAACTGTTGATGTTTTGGGTGTAATGGATGTGAATTTGCACTAG
          GTACAACGCTACTGTGCATATTGTTGAAACACAATATTTAGTTATTAGATTGTTTATCGAAAAAGTATTATTACTTAGTT
          TATGGTTTCAGAGTTTGTTCTTTTAGACAATTAACATATCTGGAGACATTTATAAATCGCAATAATTGTTACCTGTCAAT
          TAATCCAGAATTAAACCAAATTTTTGCAATAGGCGATACATTTTGCAAACCTCATTTGTAGATCAGCCTAAAAGACGATC
          GCAAAATATTATGATTCTGTTCAAATTGAAGCTTCTGTTTTGCCTAAAATATTAACATTTACAATAGTAAACCCTACCAA
          AATTACGACTTAGTTAACTTAGCAAAGAAAGTATTAGATAGTGGTAGATGAGTGAGCCTTTCGCGCTTCCTGGTGGGTTG
          GGAAATGGAATGAATTAGTTGGATAGGAATAGTTGGAAGACGAATGCAGAAAAAGAAAAGTAGATTTTTGGAAAATAAAA
          AACACGAAGCACAAACCTAAATCCAAAAACCGAAAGTAAAGACAAGTAAGACAAAACAAACAACTTTATGTAACTTGTAA
          GTAGACGTAAACTCATTTTATACGTGTGTCATTTACACAGGCTACCTTCTAAAGTGAAATCGAAAAACGAAATCTAATTC
          TACGAACTCCACAACATTTGCATAAACGTTGAACAATAATTATCGTAATTGTACTTAACTAATTGTATCTTGAATCTTGT
          ATCTAAACGAAGTACACATATCTCGAGGCCCCGTCATTGGCGTCGATATCGAGCGTTGATTAGGCTCCCAACTAAACTAA
          ACTAAATATAAAATCAGATAGTTACCTAAAAGATGCGAGTATATCCAGGCCATTTCGCAATTTTTCCCCACTCTTCATGT
          ACAAGCCATCGATCATATGCAATTATTATACATTTATATCTACATATAACACGACACATACTCATTTTATGAAATTAGAA
          ATTTCGTTATAGACACAAAAACACAAAAGAAGAACAACAAAAGTAATGACAGAAGTCAATAAGTATAAGACGTACAATAT
          TTTTAACGTAAGTAGTGTTGAATCTTCTATAATAAACTTATATATAAATACTATCAACTAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078450
          3213
          FBtr0310451
          3735
          FBtr0333893
          3204
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306024
          627
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078104
          627
          FBpp0302599
          625
          FBpp0306025
          624
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Syn1-RD
          Secondary FlyBase IDs
            References (0)