General Information
Symbol
Dmel\klar-RG
Species
D. melanogaster
Annotation Symbol
CG17046-RG
FlyBase ID
FBtr0333852
Feature type
Associated gene
Evidence Rank
Length (nt)
4934
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 54 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCAGTGTGATTCGCAACGTTGGAGCCGACGGACGGACGAAATCGGGGAGCGGACTTTATGCCAAGATAATGGCAAAAAAG
        TTAAATAGCCAGCCGACGAACAATTGCTAGAAAAAACAATAGAAAGCCCAGAGCAAGAGCAGCTATAAAATGTGTTTATT
        TTGCTTGCGAAATTTGCATTAAATAAATGGAAAACACAACGAGAAATACAAAACAGCATTCGAATTGTAAAATAAAAAAC
        ACAGCAAACATAATAGTTCAACTCATTAAAACAGTGATTTGACGTGAAATAAAACATTTACAAAATACCTGTGATCTTTG
        CTACCACTCCCGCTGAGTAGATATAAAACTGTGAGTGCCTGGAAAAAAGAAACAAATCAAATTGAAATTGAAGAAATAGT
        GAAGTAATTACTAATTTGAAAGGGCAAGGTCTCGCATGATTCAATCAAGCAGTTGGTGCTGGAAGCCGAGCATTTGGTGC
        GCGACGCCCAAGAGACCGCACTGAAGACGCCAACCAAGCAGAAACATTCCATCATTAAGATCTCGTCGACGGTCAAGAAG
        CGCGAGGTCACTATGCCCCATCCCATCAAGCAGCGTGTGGAGGAATGGCTGGAGCACCAGCCCTCGACCCCACAGCTGCT
        GACCCGGAGCCACACGCACGAGCTCCTGCCCAGCTGCAAGCCAGATGACTGTGAGGCCTCCGGAGAAGCATCCGAAACAG
        ACTCGGTGCCCCAAGCTGGAGCAGGAGTAAACGGAGGAGCACCGAATGGTGCGGGATCGGATACATCGGAGGGCTTCACC
        GATTCCATTGCCACATGTATGCAAACGAGCACGAATTCCTATGGGAATTCCACGGAGAGAATCGGTGGATCGGCTGAACC
        CATTGGACAGCCCGTCACGCCTTTGGGCTTTGGCAGCAGCAACCAGAGCCTGAATGTAAAGATTGTAAAGCGATCGCAAA
        CGCGTCGCAAGTCGGAGAGACCATGGTCGGTCTCGTGTCTGTCCCAGTTGACTACGGATGCAGCCCAGTTAACCACGGCC
        CGGATAGTGGAAAACTCTCCGTCCGGTCTGGCCAGTCACTCGATCAGTGAGAGTGCCCTGGACTCGCTTTCGCCAGGACC
        AAGACCGCGGGCAGCTTCTTCCTCGGGAACGGGAAGCAATGCAGCCAAGAAGGCGGATAGCAAGGGCTCATTGAGGAGGA
        GGAAGGCCAGGAAGAAGCGCATTTCGGCCGCATCGGCTGGCAGGAAATCTGATTCAGGTTCCGAACTGGGTGGAGATCTC
        ACCCAGACACTGATGAAGTCCTGCGAGTCCATGTCCTCGCAGCAGCTGCAGGAGTTCACCAATGCCCTTCTGAGCATTCA
        AAAAGGCGCAGTAGTTGCTCCTTTGAGTCCCAAGGGCGACGTTTCTGGAGTACCTTCACTGGCCGATGGCGAGGGAGGGG
        AAACCCAGCTGATGCTACCCAAGTTCCGGGTGGGCTCCTTCACCACAGCTGGCCTATTGGCTACTGATACGAGGTTAGGC
        GCTTTAGCAGCCCTCTCAAACTACATGAACGAGGACGAACAACAAGCAGAACTCAGCACTGAGGACCATCATAGCAGCAT
        CTCGGAGACGGCGTGGGACAACTACCAAGAGAAATACAACTCGGAGAACTATTCCGAGGGCTTTGATTCAGATGCGGCCC
        GGCGTCTCTTGGAATTCGGCGACGACTATCGCAATTTCATCGACTCGCAATCGGACTGCTGCAGTTCTCTGTCGGCGGCC
        AACAATCTGGACTCGTTCTCGCCGCCGCGCATGGACTCACTGCAGAAGCACGAGCTGAAGACCCTCCATATCAACCAGGA
        CACAATCACCAGCACCGTGGACCACGCCCGCCGCCAGCGCGCCCTTGAACTGCAGTACGAGCGTCGTCGCAAGACCCTGG
        AAGTTCGACGAAAGTCTTGCCAAGACATGGATGAGAGCCTGATGGCTAGTCCCCAGTCGGATCAACAGCAGCAGCAATTG
        CAGGTCACGCCTTCGTTGTCTGCCTCCGCCACCGCCCTAATGACCACGCCCAAGATTCAGTCGACCAGCCACCAGATTAG
        CCATCGCGCAGAATCTGTGGGACGCAAGTTGGATTTCGGCGGAATGAGCCACTCCGCTCAGTCCCTGCTGCGTCGCACCT
        CGGAGAGCGATACTTCAACCAGGAGACGACGCACTGTGACGGCGGACGAAAGAAGACGCTCCTCCCGCAACCTGGAGAAG
        TGCATCAAACTTATTCCAGCTACCACTTCCTCGTCGAGTGGCTCGGACTCCGAGGACGGAGAGCAGGAGATGCGATCCCT
        GCTGCAGCAGAGCCGCGACAGGCTGGACGACACCAGAGCCCTGAAGATCAGATGCCATCTGCTTAGACCAGAGGATTATA
        ACGAGATCATCAACACTTGCCGCGACAACATTCGCTGCCTGGAGGCCGTGCTGCGCGGTCCGCCCGGCACCGTGTTGTCC
        AACCACTGCGCTGGCCAGACAAAAGATCTGCTCGGCGCCTGGGAGGATCTACTTAGCTGGAGCGAGAATGCCTCCGCTGC
        CCGCAAATTGCAGCAGGAGATGAGTGTGTTGAAGAGCTCGCTGCAGCGCCTGGGAGACAAGCCAACTCCAGAGCTCCTCG
        ATACGGAGCCGGCCATCCAAATAGCAGTGGAGGCGCTCAAGTTGGAGCAGACGCAACTGACCAGCTATAGGACCAACATG
        CTGCGTCTTAACGCCTCCGTCCACAGTTGGCTTACCAAGCAGGAGCGGCGACTGCAGAGCGCCTTGGAGGAACAGGAGCA
        GCAACAGGAGTCCGAACAACTCAAGCAGCAAAAACTTGTTGAAGAGGAGAAGGGAGCTGACGTTCAGAAGGAGCTGGCGT
        CTACCGGAGCAGTGGCCATCACGGTCACCGACAGCAATGGTAATCAGGTGGAGGCACTAGCCACAGGAGAAGCCTCCACC
        TCCACGCCAGCCTGGGATGTGCACACGCTGATGTCATCGGAGCAGGAGTTCCATAAGCATCTGAAGAACGAAGTGAGCGA
        CATGTACAGTTCCTGGGATGAGGCGGATGCCAGAATCAACACGCAACTGGAAATGCTTACCAACTCGCTTATTGCCTGGA
        GGCAGTTGGAGTCCGGTTTGAGTGAGTTCCAATTGGCTTTGGGCCAAGATAGGGGCACTCTGAAGGGTCTTGAAGGAGCT
        CTGGACAAGGGACAAGCCACACCAGTCGAGCTGGCCCAGAATGTAAAACTGGTGGCCAAGCTGCTGTCCGAAAAGGTTCA
        CGTAAGCCAGGAGCAACTTTTGGCCGTCCAGCAGCACCTGGACCCCAACCACATCTACCACATTACGAAGTTTACAGCCT
        CAAATGGCTCGCTATCAGATTCCGGCATCTCTGATGGAGGAGCTACTTCTGATGGTGGCCTGTCCGAGAGGGAGCGACGA
        CTGGGAGTTCTTCGACGCCTAGCAAAGCAGTTGGAACTAGCTCTGGCGCCGGGAAGCGAAGCCATGCGTTCTATTGCTGC
        CCGAATGGAAAGTGCCGAGGCCGACCTGAAGCACCTGCAGAACACCTGTAGAGACTTAATTGTTCGCACTGCAGCTAGCC
        ACCAGCAGAAGCAGCAGATCCAGCAAAATCAGACCCAGCAGGTGTCACCGAAGGCCAATGGACACATTAAGAAGCAGGCC
        GCAAAGGGCAAGGCAGAACCCCAGTCGCCTGGCAGACGTGGTAAAGGAGCTCGAAAGGCGCGTCAGGCCAAGAAGGCTGG
        AGAGGATCAGCAAGTAGAGGAGCCAAGTCTCAGCCCAGAACAGCAGAAGATGGTCCTGAAGCAACTCAAGACCTTGACAA
        GTGGCGATGGTGGGGACGACCCCTCTGACGATCCCTCGTTGCTCTTCAACCTGGAAAGCTCCGAGGAAGATGGAGAGGGA
        GCGGATCCTGCACAGACCTCTAAGCGAGGGTGGGCGTGGCGCATCGCGAGGGCGGCAGTGCCTATGCAGGTGGCCCTGTT
        CACAATCTTCTGCGCTGCCTGCCTGATGCAACCCAACTGCTGCGACAATCTGAACAACCTGTCCATGAGCTTCACGCCGC
        AGCTCCGCTATATCCGTGGACCACCTCCGATCTGAGGACAGAGCGCGACTAATTAAGCAGGCCGCTAATCGTTGTAGGTT
        ACCGTTACGTTATGTTAAGGCATTTAACAGCTGTAACTAGAGTTAACCAGCGCAACCAGCCACTTAGGCAGAGCCACTAA
        GAGCTCGCCTGTGGCGCGCGTTTTCCGCGCTCGAGGTTTTACAATCCCGAACAGAGCGCTCTCCTCCGAAAGGTGCGACA
        CCCAGAGGCAGCCCAATTTTATATGTCTAATTTAGGTAGCGAGCGCGAAAGGAACGCAATTTATAGTAAGGATGTATTTG
        TTATTTCGGTTAATTTCCTACGAGTTTAGGTTGCTGTTCGATTGAACGCTGAATATGTACTTAGGCGAGGAGCAGACGAT
        GCCCAGCCACGTGTAAACTGCCGCATAAAGGAACAAAGGGGCGGATCGTCCCCCAGATTCTTACCCAGTAAATATGATAC
        AAACACAATGATCAATTGAGTGGCGTTTTTGTATACTTTTTTGTTTGAAAAACACTAAAGTGCCTACAAATGCGAACTGT
        GAACGAGGAGCTACCAGCAGATGACAAAGGATCCGTCGAGGAGTCCAAACGAGAGTATGAATCCAAGGCACCGAAGCAAA
        CAGAAGCTAAAAAGCCAACAGCACTAAGGAGCTAGCAATGGAGCTCACCAGAACAGCGATGAAGAATCAGAGTTTATATT
        TTTATACGCAACGCAACTATACACAATCAGTGCGGAGACAACGAATCTTCAGCCAACACACATCATACGTTTTATGTCTA
        TTATATTAATAGGATAAACCTTACACTTATTTTGCAAGAAAACAAAAATTCAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0072565
        8706
        FBtr0110818
        8271
        FBtr0112807
        3032
        FBtr0112808
        6867
        FBtr0333850
        8642
        FBtr0333851
        7528
        FBtr0343526
        5689
        FBtr0343527
        2708
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305985
        1180
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072464
        2262
        FBpp0110115
        2045
        FBpp0111719
        567
        FBpp0111720
        1823
        FBpp0305983
        2272
        FBpp0305984
        1636
        FBpp0310130
        1197
        FBpp0310131
        511
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        klar-RG
        Secondary FlyBase IDs
          References (0)