General Information
Symbol
Dmel\msi-RE
Species
D. melanogaster
Annotation Symbol
CG5099-RE
FlyBase ID
FBtr0333663
Feature type
Associated gene
Evidence Rank
Length (nt)
2840
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Sequence
        TCAGTTTGCCTGCGACCGTTACAACAGCCAGTTGATTCGAAGCGGAGCGATTCGTGGATTCGTTTTCATCGTGTCGTCGT
        CGTTTTGTCGTTGATTTCCGTTTGTGCATGCAGATAAAGCCAGGTCTTAACTTGATTCTGGACTGGGCCGAAAATCGAAA
        TCGAAACCGAAGTGGGCTAATGGAAAATAAACAAACAAACAAAGCTTGAATTTTGTTTGCCGCGCATTTAAAAAAATCTG
        AAACCTTGCCATCTAATATTGGTGGTATTAAAATGAGTATTACCTAAGAAAAACAAAAATAATTCAGTGCGGTTATAAAA
        TACATAATATTTAACAAAATAGTTGCAAAAAGTCAACAGAAAAGTGCAAAAAGAAAAAAATCTCAAGAAAAACAAAGTAT
        TTGGTGCGACCTAAAGTGATTTTCTCAGCGTGTGTCTTTGGGATAAGCGAAAAACCAGCAAAATTTACTGCTTTGGAAAC
        TCCGCTCTCAACATAAGCACCAACAACAACACCATCAACCCCCCCGGCGGCAGCAGCACCCACCTCCAGATTCAGCACCA
        CCAGGCTCAGCACCACCCCCAAAACAGTGCGAGAATGCTGTTCGAGAATCCGGCGGTTGCGGCCAAGTTGCCCTTTCCGT
        ACAACGTGCCCCCGCCCCTGCAGGCGGCGGCGGCAGCAGCGGCGGCTGTCCCAAATCTAAGGTCAGTATCGGAGATGAAC
        GCCACTTCTCTATATGCCGGCAATCCCATGGAGAACGCGGCCGCAGCAGCCGCCGCCGCAGCAGCGGGCTTGATTGATCC
        GCACCACAATCGCGATCTCCACCAGGCGCTGGTGGCCTCGATAGCCAATAATAGTGTGGCCGCCATCGGCGGTGGCCTGA
        CCACAGCGGCAGTCTTGAAGAGTGCCGCTCAGCAGTCCCAGCAGGCGGTGCAACAGAACCAGAACGCGGTAGTGGTGACA
        CCGGGACTGGAACAGCCCAAACAGGAACCAGCCCAACAGGCGGCACTGGCGCTGCTCAAGGAGAATGTAAACGCCTCCGC
        CGGAGCGGGACAGAACAACGGTCAGGCGGCCATGGGTGGCAGCAACAAGAGCGGCTCCTCTGGCAGATCCACGCCCAGCC
        TGAGCGGAGGCAGTGGCTCCGATCCGGCACCCGGCAAACTCTTTGTCGGCGGTCTCAGCTGGCAGACGTCGTCTGACAAG
        CTCAAGGAATACTTCAACATGTTCGGCACCGTCACCGATGTGCTCATCATGAAGGATCCCGTCACCCAGCGCAGTCGCGG
        CTTTGGTTTCATCACATTCCAAGAACCCTGCACCGTGGAGAAGGTTCTCAAGGTGCCCATTCACACACTCGATGGCAAGA
        AGATCGATCCCAAGCATGCCACCCCAAAGAATCGACCTCGTCAGGCCAACAAGACCAAGAAGATCTTCGTGGGCGGCGTC
        TCACAGGATACTTCGGCCGAGGAGGTTAAGGCTTACTTCAGCCAGTTCGGACCCGTCGAGGAGACGGTTATGTTGATGGA
        CCAGCAGACAAAGCGCCACCGTGGCTTCGGATTTGTCACCTTTGAGAATGAGGATGTGGTCGATCGCGTATGTGAGATTC
        ACTTCCACACCATCAAGAACAAGAAGGTCGAGTGCAAGAAGGCACAGCCCAAGGAAGCAGTCACACCGGCTGCTCAGCTT
        CTCCAGAAGCGCATTATGTTGGGCACCCTCGGCGTCCAGCTGCCCACAGCTCCTGGCCAGCTGATTGGAGCCCGTGGTGC
        CGGCGTGGCCACCATGAACCCACTGGCCATGCTTCAAAATCCCACACAGCTACTGCAATCCCCGGCAGCAGCCGCTGCCG
        CCCAGCAGGCCGCCCTCATATCACAGAACCCATTTCAAGTACAAAACGCCGCTGCGGCAGCCTCGATTGCCAATCAGGCT
        GGCTTCGGCAAGCTGTTGACCACATATCCGCAGACTGCGCTGCATAGCGTCAGATATGCACCCTACTCGATCCCCGCCAG
        CGCCGCCACTGCCAACGCCGCCTTGATGCAGGCTCATCAGGCGCAAAGCGTGGCCGCCGCTGCCCATCATCACCAGCAGC
        AGCAACAGCAGCAGCATCATCACCAGCAGCAGACCCACAATGCCCATGTGGCCGCCGCCCAGCAGCAGCAGCAGAGCCAC
        CACAACGCCGTCTCGAATCCCGCTTCGCAGGCGCACTCGGCAGCAGCGGCTGCCGCCCTGGCGGCCAATGCCGCGAATGG
        GGCAGGTGCCGCTGGAGCCCACAGCCTGGCCGCTGCCGCTCAGCAAGCTGGCTTAATGGCCGGCAATCCCCTGAATGCCG
        CTGCTGCCGCCGCCGCCGCTGCTGCCAATCCGGCGGCTGCCTACTCCAACTATGCGCTGGCCAACGTGGACATGTCCAGC
        TTCCAGGGCGTCGATTGGAGCACCATGTACGGCATGGGCATGTACGTCTAAGACGCGAGTTTTGTTTGGTAATTTGAATG
        AAACACTCTCACCATGCATACACCATTCACAACCACCCCCCATACACCCACAACCACTACCACATGTGAACAGCAGCCCC
        CCACATCCATTAATATTCATAGAACCACACACAAACACTCATACGAAGTTGGTTTTCCTTTGAGTTTGGCTAAGTTAGTA
        GTCCGATACACGGAAGGCAAATTAAGTATTATATTTAAGGCGCCCTCGAGCGAGTTCGATAAATACTAACTAATATATAT
        ATATATAACAAATCATAAGCAATATAAGCGAGAAAAAAGAACAAAAACGGAAGCAAAGCAAAGCGAAGGAAAAACAAAAT
        TTAAAACCAAAAAGCAAAAATTACGGAGCGTTAGAGAAGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0084882
        3984
        FBtr0084881
        2806
        FBtr0305218
        2888
        FBtr0305219
        2801
        FBtr0333664
        10175
        FBtr0333665
        2676
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305819
        618
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0084256
        606
        FBpp0084255
        634
        FBpp0293748
        634
        FBpp0293749
        605
        FBpp0305820
        634
        FBpp0305821
        567
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        msi-RE
        Secondary FlyBase IDs
          References (0)