General Information
Symbol
Dmel\br-RQ
Species
D. melanogaster
Annotation Symbol
CG11491-RQ
FlyBase ID
FBtr0332293
Feature type
Associated gene
Evidence Rank
Length (nt)
4235
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTTCAGTTACTAAAGTTAGTTCAGCCTAAACGCACAATTTCAATTTCCATTTCTAAGTTTGAGCCCGAATTGAATAGCAT
          TAGTGCCCACCCCACGCCTACCCTCGCACCACCGCACCAACGCACCACAGCAGTATCCAACACACACACGAGGACTGGAC
          AATTCCCTCTGTTCTATTTTTTTGTGTTTTTTGTCAAGTGCACCCAAGCAAAGACCAAAGGACGCAAACCATCTAGTGCG
          CGATTCGCGCGCGTTTTGAATCAAAAGAATCTAAGAATCCAAGAATAGCTAAATCACTGAATCGCAGAATCAGGAGCGGA
          AAAAGCGAAAGCCAACCCCAAAAACCCAAAGCCCCAAAAGTTCAAGTGAATAATCAGTGTGCATCCCCAAGTAGTCGACC
          CAATGAAGCGCCGCCATGAGCAAGGATGCACCTACTGAGCGCAACTACAACCGCACCATCCAGCAACCCACTCAGGCTTT
          TGCTGATTCTATTTCGATCGCAATCGGTCTCAGGAATCAATCTCAGGATTAGCTCTACGGCAGTTAAATAATCATTAGTG
          AAAGGTCCATCTGCAGCTTCACAATCCGGCAAGCGGTCTAGTAATCAGCAGCCAGAAGGAGCAGCGCATCGCATCGTAAC
          GCATCCTTAGTTTCGGTGGGCCAGGCCGCCAGAAAGCCGTCAAAATACGAAAGAAGGTGACCTCGAAGAAGGCCAGCGTT
          GTGTCGGTTGACGACGATCACAACAACAACAACAACCACAACAACGACCACAACGCTCGGCAGCCCACAAACACAGCGAA
          CACAAGCACACCCACACCAATAGGAACACCTATAGACACGCCCACGCCCACGCCCGTTGACCCAGAGCAGGAGTGCCCAC
          AGCCCAGGAGCAACCCGATCCACAGCCAGAACCAGACACCCATCGAGATGGACGACACACAGCACTTCTGCCTGCGCTGG
          AACAACTACCAGAGCAGCATAACCTCGGCGTTCGAGAATCTGCGCGACGACGAGGCCTTCGTGGATGTGACCCTCGCCTG
          CGAGGGACGCAGCATCAAGGCACACCGCGTCGTCCTCTCCGCCTGCAGTCCCTACTTCCGCGAGCTGCTCAAGAGCACAC
          CCTGCAAACACCCGGTCATACTGCTGCAGGATGTCAACTTCATGGACCTGCACGCCCTGGTGGAGTTCATCTACCACGGC
          GAGGTCAACGTGCACCAGAAGTCCCTGCAGTCCTTCCTTAAGACCGCCGAAGTGCTGCGCGTCTCTGGACTCACGCAGCA
          GCAGGCAGAGGACACACACAGCCATCTGGCTCAGATACAGAACCTGGCCAATTCCGGCGGCCGCACGCCGCTCAACACGC
          ACACCCAATCGCTCCCACATCCGCACCATGGCTCGCTACACGACGACGGCGGCTCCTCGACCCTCTTCAGCCGCCAGGGA
          GCGGGTTCGCCACCGCCGACGGCGGTGCCATCGCTGCCCTCGCACATCAACAACCAGCTGCTGAAGCGCATGGCCATGAT
          GCACCGCAGCAGTGCCGCCGCCGCCGCCGAGGAGACCTCCCACGCCTTTAAGCGTCTGCGCGGCTCGGACAACAGCCTGC
          CGCTGTCCGGCGCCGTTGGCAGTGGCAGCAACAACAACAGCCCCGACTTGCCGCCGCTTCATGCGCGCAGCGCCTCGCCC
          CAGCAGACTCCGGCCGACTTCAGTACGATCAAGCACCACAACAACAACAACACGCCGCCGCTGAAGGAGGAGAAGCGCAA
          CGGACCCACAGGCAACGGAAACTCTGGCAACGGCAATGGCAATGGCAACGGAGCGAGCAACGGCAACGGAATCTCCATCA
          GCGACAAGCTGGGCAGCCTCACACCTTCGCCGCTGGCTCGAGCGGGCGCCGATGATGTCAAGTCGGAGCCCATGGACATG
          GTCTGCTCTAACAACAATGCCAATGCCAACGACGAACACAGCAACGACTCCACCGGCGAGCACGATGCCAATCGCTCCAG
          TAGCGGCGACGGCGGCAAGGGATCCCTGAGCTCCGGCAACGACGAGGAGATCGGCGACGGACTCGCCTCCCATCATGCCG
          CCCCTCAGTTCATCATGTCGCCGGCGGAGAACAAGATGTTCCATGCAGCCGCCTTCAACTTTCCCAATATCGATCCCTCA
          GCGTTGCTAGGTCTCAACACACAGTTGCAGCAGTCCGGTGACCTCGCCGTGTCCCCTCAAGGTGGCAGCACCGGCAGCCT
          ACTCAGTGGCGTCATTGTGCCCGGCGGTAGTGGTGGCACCCCTAGTAATAGTAGTAGCAACAACAACAACAACAACAGCA
          ACAATCAACAACAAAAAGTAGAACAACAGTCATCACCACACCAACTCCTCCAACAACAACATCATTCCACACCACATACC
          AACAGTCCACAACTGAAGCAGGAACAACCGAAATCGGGCGGCGGGAGCTGCAAGTCCAGCGACCTGCACATTGCAGCGGG
          TAGTGAGCGCAGCCTCTCCCGATCCTCCCAAGGAATGCCAGACGCCGGCGGGCACAGTGCCACGCCCTCGCCCACCGCCG
          CCTACCACAAGCGCGAGAGGGAGCGCGAAAGAGAACGCGAACGGGAGCGGGAGCGCGAGCGGGAACGCTCGCTCGACCAT
          GAGCGCGACTTGGAGAGGCCAGGCGGCACCGGCTCACCACCACCGCCGCCGCCGTCGCACCACTCACATTTCGGCCAGCA
          CCCATTGTCGCTGTTGCCCAGCCACCACCAGCTGCACGCGACCCACCACGAGCTGAGCGCCGCTGCCGCCCACCACGCTC
          ACGCCCATGCTCATGCCGCCCACGCCCATGCCTTGGCACGCGCCGGATCGCCCATGGAGCACCATCACCTGTTGCACCAC
          AGACGCGCCTCGCTCTCCCCCTCGGGGGCCGTTTCCTCGGCCAGCGGAGCGGGTGGACGCGGAGGCGGCGCTGGCGGACC
          GGGAGGACCCGGCGGCAGCCTGCTGTCATCAGTGCGCGCCCAGGACGTGGCCCAGGCCAATAGACTCCTCCTGCCCCTGC
          CCCTCAACGCCTGCCACCGGTGCGACGTGTGCGGCAAACTGTTGAGCACCAAGCTCACGCTGAAACGCCACAAGGAGCAG
          CAGCACCTGCAGCCGCTGAACAACGCCGTTTGCAACCTGTGCCACAAGGTCTTCCGCACGCTGAACTCGCTGAACAACCA
          CAAGAGCATCTATCATCGCCGCCAGAAGAACCACCACTCGTATTTCCACCACGGCGCCGGGGTTAGCCAAGCGGGCAGTC
          CGGGCAGTCGGCTGCATCAGTCGCTCAGTTCGTTGAGCGCAGCAGCAGCGGCGGCCAACAATAGCGTTAATGTGGGCGGT
          GGATCGGTAGGCGGGGCCGGGGGCAATGCAGTGGCTGCTGCTGCAGCCGCAGCTGCCGCGGCGGCCGAACTGCTTCTCTC
          TCCGATCGTTGGCGCCGCTGCCGTGGCCGGGGGTACGGCCAGCTCCACGCTCCAGCTGGCGGCGGCGCACCAGCAGCAGC
          AGCAACAGTCGTCGCCGGGCATTGTCAAACCGTGCATGGACTTCTTATAAGATCAGCAGCAACTCTTGCAGCAGCTGTTC
          CACGTGGCGCTCAACAACTCCGCGGCGGCAGCGGCGGCTGCAGCGGCAGCAGCTGCGGCGGGTGGATCGGGAGGAGGCCC
          AGGTGGAGTGGGAGCTGGGCCGGAGTCAATCAACGGAGGCGGACAGGAGTACGGAGGAGTGCAGGGGCCGAGTGGCACGC
          CCACTGTCGATCTCACCCAGCTGGAGCACGCGGCCGGGGGCGGTGGATTCTCAGCCGCCGCCGCCCTGCAGCACCACCTG
          CCACACCACCTAGCACATCAGCATCCGATGTCCCACCAGCATCCCCACCAGCTGACGCACCAGCACCCGCATCCCCATCC
          GCACCAGCATCCATATGAACGCATGAATTTACTAGACCAATAAGCAAGGCGCCAGAAAGTATGCTACGAATGATGATCGG
          GCAACAGACACACGCACACGCGCACACAAAGGCACACACACACACACAAAGGAGGAGAAGGACGAGGAGGAGGAAGCGAG
          GAGGAGGAAGCGAGGAGGAGAACAAGGAGGAGGAGAAGGAGAAGAACCGACCGAACGAAAAAGGAGCAGAGGGAGATTAG
          GACTATACTACTACCACGTAGACATTTCAATTTCGGATCTCACAGAACGGAAAATTCAAAGACTTTTTCGGCCAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0070265
          8223
          FBtr0070263
          7839
          FBtr0070261
          3867
          FBtr0070262
          4419
          FBtr0070266
          4236
          FBtr0300427
          4305
          FBtr0300428
          3981
          FBtr0300429
          3119
          FBtr0303562
          9822
          FBtr0303563
          4213
          FBtr0303564
          4546
          FBtr0308319
          4368
          FBtr0330406
          4188
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0304572
          880
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0070255
          702
          FBpp0070253
          880
          FBpp0070251
          880
          FBpp0070252
          724
          FBpp0070256
          663
          FBpp0289656
          880
          FBpp0289657
          880
          FBpp0289658
          514
          FBpp0292595
          514
          FBpp0292596
          724
          FBpp0292597
          724
          FBpp0300638
          663
          FBpp0303432
          1011
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          Z4 isoform (Z isoform identity refers to which of 4 zinc finger domains the protein isoform contains). FBrf0094125.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          br-RQ
          Secondary FlyBase IDs
            References (0)