General Information
Symbol
Dmel\DCX-EMAP-RG
Species
D. melanogaster
Annotation Symbol
CG42247-RG
FlyBase ID
FBtr0331181
Feature type
Associated gene
Evidence Rank
Length (nt)
4392
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAAAAATATTATTTAAAATGACTTAAATTAAATCCTTAATCAAATTTCTAATCAAACATTTTCCACTTTAGCCAGGCCAG
        CAACGTAGTTCTTTGCTGGGCAACCAGCGACTGCGTGCTCGAAGAAAACCTCCAAGAAGTTGCCCCCCTTTTGGGAGCTC
        CAAGTTTTCCTTTGCGTCGACGCGACGCTGCCCTTAGCGATTCCGTTTGACCACAACAAACCGAGCACGCAAGTTGAGCC
        AATTCCTTAAGAGAAAGCTGACGTGACTGCTTTAGGAGCAGGACAAGCAACAGTACCAACACCAGGACAATGTCCAACGA
        AGAGAACGACGACTATATGGCCAGCTTGAGTCAGGCCCAGACCGGCGAGGATGAGGTCGATGGCGGTGGAGAGGCAGCTG
        GCAGTAACGACTCCGTTCTGGGCGGCCAAACAATGCCACAAATTAGTCCGAACGCACCGCTCGAGGGAAACGTTTCGCCG
        CCACCGACGCAGCCCCATTTGGATGATAATCTGCACAACGGGAACGGGAACGGGAACGGCATCCACAGCAGCAGCAGCAA
        CATTAACAAGCACGGCAGCAACATCAACGGCAACAACGATAGCAACCGCAGCAGTCCTGCGAAGAGTCCCAAGCGCCCAG
        TGTCCTCCAGCTTCCGGATTCAGAACACCAGCCGGTACGATAATGATGAGGAGGACTTAGCAGCCAGCGAGCAGGTGGCT
        GGTGGAGATCGCCAGGTGCCGGATTATTGGCAGCAACGGAACGGTGCGACCACTGGTGCAACCAGTGGGCGGCAGAGTCG
        CGCCATTAGTCCCGGGTATCTGGACAACATGAGCGAGAACTCGGAGCAGCCGCCAGTGGTGCCGCTGGTGCGATCTAAAT
        CCCGTCCAGAAATTTCAAGTGCAGCGGCATCGCGATATAATAATCTCTCCTATTGGAAGGCACGCCGTGTGGTGTTCTAC
        CGGAATGGGGATCCATTCTTTCCGGGTGTGGAGCTGCGCTATCGTCCCGGACGGGATGTAACCTCACTGGACAATCTTCT
        CGATAAGATCTCGCCCAAGATGGACTTGCCACGGGGTGCTCGATATGTGTTCTCCATGGACGGAGATCGAAAATATCATC
        TCGATGAACTGGAGGATGGAGCCTTCTATGTCGTATCCTCGTTCAAGGCCTTCAAGCCTGCCAGCTACGGCAAGAAGAAC
        GGGATGTGGTATGCATCGCCTGGAAATCAGGGATGGGGCTCCAAGCCCGCCAGTCGGAAGCCCTCAATAATGGAAGCGGA
        TTTGGGCACATTATCGACCACATCAGGCTCGATAAAGCGCAGCGCCGGCCGTGTGATACGCATCATCAATAATTTGGATC
        ATTCGGTGCAGTGTCGCGTTTTGCTGAACCTACGCACCTCGCAGCCGTTCGAGGAAGTGCTAGAGGATTTGGGTCAAGTG
        CTGAAAATTAACGGAGCAAAGAAAATGTACACAGGCACTGGCCAGGAGGTCCGCAGCTTTTCCCAGCTACGGAATGAGTT
        CGCCGACGTTGACACCTTCTACCTGGCCACGGGAACTGCCCTGATTGCCGGCTCACCCATCCGGCGCTCCAGGTCCCGCC
        CCTCGGTGGTGGCCGCCGCACCCATTTTGCCCACGGATGAGCTGCCCAAGGTGCCGCTGCGAGGAGCCCGTCCGCGGAGC
        AAGAGCCGACCGCGGATCCTGTACGCTCCGGAGAGCGAGATCCTGCGGCCGAACGGCGAGTACACGATGCTGGACATCAT
        GAAGGAGGAGCCCACCAAGGTCACAATCCGGGGACTGCGGCGCACCTTCTATCCGCCCGTTCACCATGCGCCGGCCGACA
        ATTCCCCGCCGGACAAAAAACTGCAACTCCAATGGGTCCATGGCTATCGCGGCATTGATGCGCGGCGAAATCTCTGGGTT
        TTGCCCTCCGGAGAACTGCTCTACTACGTGGCTGCCGTGGCCGTACTCTTTGACCGCGACGAGGATGCACAGAGGCACTA
        CACCGGACACACTGAGGATATCATGTGCATGGATGTGCATCCCTCCAGGGAACTGGTTGCGTCTGGACAGAAAGCTGGAC
        GAGATCGCAAGTCGCAGGCGCACGTCCGCATCTGGAGCACCGAGTCCCTGCAGACGCTCTACGTCTTTGGCATGGGTGAA
        CTGGACAGTGGGGTGACAGCAGTAGCCTTCTCGCAGCTGAACGGAGGTAGCTACATACTGGCTGTGGACAGTGGACGCGA
        GAGCATTCTGTCCGTGTGGCAGTGGCAATGGGGTCACCTGCTGGGCAAAGTGGCCACCCTGCAGGAGGGTTTGTCGGGGG
        CTGCCTTCCACCCGTTGGACGATAATCTCATCATCACCCATGGACGTGGTCACCTGGCCTTCTGGCACCGGCGCAAGGAT
        GGCTTCTTTGAGCGCACGGACATCGTGAAACAGCCGTCGCGTTCCCATGTCACCAGTGTGCAATTCGAGCCGGATGGCGA
        TGTAATCACTGCTGATTCGGATGGGTTCATAACCATTTACTCGGTGGATTCCGATGGCGCCTACTTCGTCCGCACGGAGT
        TCGAGGCGCACAACAAGGGCATCGGATGCCTGATCATGCTGGGCGAGGGCACCCTTCTCTCCGGAGGCGAGAAAGATCGC
        AAGATCGCCGCCTGGGACTCCCTGCAGAACTACAAGAAGATTGCCGATACAAAGCTCCCGGAGGCCGCCGGTGGAGTACG
        TACCATCTATCCGCAGCGGCCCGGACGGAATGACGGGAACATTTACGTGGGCACCACGCGGAACAACATCCTGGAGGGCT
        CGCTGCAGCGCCGCTTCACCCAGGTGGTCTTTGGCCACGGACGTCAACTGTGGGGATTGGCAGCCCATCCGGACGACGAG
        CTATACGCTACCGCAGGGCATGACAAGCACGTGGCCCTGTGGCGCAAGAACAAGCTCATCTGGACCATTCAAACAGGTTA
        TGAGTGCGTGGCACTGGCATTCCATCCCTTCGGCACCTTGGCCGCCGGAAGCACCGAAGGTCACCTGCTTGTCATCAACT
        GCGAAAATGGGGCAGTCATGCTGACCCTGAGGGTATGCGGGTCGCCCCTTAATTGCGTGGCTTACAACCAGGTTGGCGAC
        ATGATAGCCATGGGCTCCCAAAACGGTAGCATTTATCTGTTCCGCGTGTCGCGCGACGGCTTCTCGTACAAGAAGGTGAA
        CAAGATCCGAGGATCGCAGCCGCTGACCCACTTGGACTGGAGCATGGACGGCAACTTTGTGCAGACGGTGACCATCGATT
        TCGACCTGCTCTTTTGGGATGCCAAGTCCTTGTCCCCGGAGCGCAGTCCCATTGCCATGAAGGACGTCAAGTGGCTGACC
        AACAACTGCACCGTGGGCTTCCTGGTGGCGGGCCAGTGGAGCAACCGCTACTATAGCACCACCAACACCATCGTGGCCAC
        CTGCAGTCGCTCCGCCGCCCACGACATGCTCGCATCCGGTGACGCCGAGGGCTATCTAAGATTGTTCAGATATCCCTGCA
        TCTCGCCGCGCGCCGAGTTTCACGAGTCGAAGGTGTACTCCGGGATGCTGGCCTGCGTCCGCTTCCTGTGCGGCGACCAC
        ACGCTCATCACCGTGGGCGGCACAGATGCGTCCCTGATGGTGTGGGACATTGTCGAGGAATAGCTGAAATGGCCACCGTG
        GCACCGCACCGCCGCCCAGTACGAGGCCAGTTACTCGGACTACTGGCACCGACGCGCCTCGAGGGTCTCCTCCACGATCC
        TCGACAGTGATTCGGTGGACTATCCGTAGTGCTGAGTACGAGGGATATCGGAGATGGGCGGCGAACTGCTTGCTAGACCC
        AGACGAACTACAATTGGCCAGCGTTCCGTTTTTGGTTTTAGACGAACAAAATATTGATATTAGATAATTGCACCTAATAC
        GAGAGAAATTCAACATTTTCGAGAAGTTTTTGAGAAAAGAGAAAAAAGAAACCCGCACTAGCAACCGAGCACCGCAGTCC
        AGCAATACAGCAATCCAAAAGTCGGCTTCCACTCAGAAATTGATTCTTCCGTTTCGGTCTTGCCATCTGCATTTGTCCCC
        TACGCTCCACATTTGTTTGAGCCCCTCGAACAAACTCTACATGCCACTGGTGGATCTAAAACTATAACCCTAAACGACGA
        AACCGCATATAAATACTTCATCTTCCAGAATGTTGTCAGAACTCTTCCGAACAAATGCAGCAAATCCAGACAGCAAGTGA
        CAAACAGACATACATCTCACCCGAATCACCTACACGGATAACGAAACCCAAGTGCACTTCCAACATATATACTTATATAT
        ACATATATCGAATGTGTATTGTTACAGCAACTTTTATTATAAGCGTTGAAATAAATAAACAGTTTGAAACGG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0299509
        4392
        FBtr0299510
        3415
        FBtr0330139
        3017
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0303608
        1118
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0288783
        1076
        FBpp0288784
        819
        FBpp0303172
        851
        Comments
        Stop-codon suppression (UAG) postulated; reflected in aa sequence of predicted polypeptide.
        Transcript terminates at site supported by polyadenylated cDNA.
        translation_exception: stop_codon_readthrough
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        DCX-EMAP-RG
        Secondary FlyBase IDs
          References (0)