General Information
Symbol
Dmel\spg-RD
Species
D. melanogaster
Annotation Symbol
CG31048-RD
FlyBase ID
FBtr0330303
Feature type
Associated gene
Evidence Rank
Length (nt)
6722
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGTTCTTCAAACAGCTGAGCGGCGGACGGATATTTGTTGTTGCTGCGCCCGGGAAGCTGCGCAGCGGAGAACGCGAAAA
          ATAATAAAACGCAAAAAATAGCGAAAATTAAACGCGTTGCAAGTGCAGCAGAAAACAACGCGAAGCAGCAGCGACAAAAT
          GTGGATACCTTCGAACAACAAATACGGAGTTGCCATCCACAACTGGCACGGCGATGTCCGGTTCGGCCTGGCACTGGATG
          TCGGCGATTCCGTGGACATTGTGGAGGAGTGCAAGCACTGGTACCGCGGCTCCTGCCCCCGAAAGTCGCGGGCAGTGGGT
          CTCTTCCCCAAGACCTACATACACATCAAGGACCTCTCGAAAATCGATCCTGTGGTCGCCGAATGCACGCAGGTCCTGCG
          CGAATGGTCGGAGATCTGGAAGCGTCTCTATGTGGATCGCGAAGCGTATAAGTTCCAAACCCTGCGCAAAGTTATGTTTT
          CCATATTGGAAAGTCGGAGGGAACTCCTTAGTGCCACCATGACTCAGGATCAAACTCTGGAGCTTCAGATGGTTGTGGTT
          TCAAAGATAGATTGGGGCAATCGCAAACTCGGCCTGGACTTGGTGCCCAGAGAGGGACCACTGGCGGTGGATCCACATGG
          CATTGGCATCGTGAAGCTCTACAATGTCCACGTGAGCAGTGCTGATAACGCCAAGGCCTCCTCGAGTCGGGGAACTTTGA
          GGCGGAAGACGCAGCGCAAGATACTCACCCACCACCTGTACTTTTGCATGCGCGATTTTGGCCATCGGATCGGTGGCGAT
          GATGCGGAGGTCTACTTCTTCCTCTATGATGGGAGTCACATGCGACCGCTGTCCGAACGGTTTCTGGTCAAAATCTCCAA
          GGATGGTTTCTCCAATTACATTGAAAGGTTGCACAGCAACTGCACGGTGTTCACTGACTTGGGTGCCGCTGATCTAAATG
          AGGAACTTCACCTGGTGGCCGTGGTCATGCGCGTGGGCAAGATCATTCAGTCGGACTCAATTAAGAAGATCGAGAAGAGT
          GGCACGTTGGGTCACGGTCCAACCTTTCGTCGACCATTTGGAGTGGGTGTTCTCTCGCTGGGCGACATTGCACACTTCGA
          TAGCAGTCTGGAGCAGTCCTCCGATGAGCGGGAGTATAACTTTAAGCTGTTCCAGTGCGAGGAGAAGGACTTTCACCTGC
          TGCCCGAACTGATTATCAAGAAATCGAGCGGGAAGTACTCGCCCATCCAAGCGAGTCAGGGAACTCAGGGCATTGTTGTG
          TCTCTAAAACTCCTGCACGGTGGGCTGGGTCAGGCTCGGCAGGAGCAGCCGATGCTCTTCCAGGGCTCTACGATAACCAG
          GAAGATGGGCTTCCCGGATGTCATCATGCCCGGAGATGTCCGCAACGATCTCTTCCTCAATCTGGAGCGCGGTGAATTTG
          AGCGCGGCGGAAAGAATACGGGAAAGAATATCCTCGTTACGGTTGTGGTGCTCGATGTGGCGGGTAATGTTCTTACCGAC
          TGCCTTTGGGGTGCCTCCGGCATGGAATCCCAGCCGCAGTACCGGTCCATGATCCTATACCACCAGAATGCTCCCAGTTG
          GAATGAGATGCTGCGCCTCAGTGTGCCGATCGACAAGTTTTCAACGGCTCATGTGCGGTTTGAGTTCCGACACTGTTCGA
          CGAGGGATAAGACGGAACCGAAGCTATTCGCCTTCAGCTTTGCCAGACTAATGGACACCGGAGGTGCTACTCTGGGCGAC
          GGCCTGCACGAGTTGTATGTGTACAAGTGCGAGGATCCTGCAAAGCTTCAGGTAGCTAACTATCTGCGGTTGCAGTGTAG
          ACCCCGCGATGCACAGGCCAAAATGGATTGTGGCGGTTGCTTCAGTCGCAGTTCCAAAGAAGTGTTCGTTCTGCGCTCCC
          TGCTCTGCTCCACGAAGCTGACCCAGAACGCTGACCTTCTCTCGCTGCTGCAGTGGCGCACATATCCCGAAACGATCCAG
          GACTCGCTGACGGGAGTCCTTCGGCTCAACGATGAAGAGCTGGTCAAGTTCCTGCAGGACGTGCTGGACGCCCTGTTTGC
          CATGTTCTCCAATGAGGAGGGTAACAGCACCCAGCACTCGGGCCTGGTCTTCCATGTCCTAGTGAGCATCTTCAGCCTGT
          TGCAGAGCAACAAGTTCCAACATTTTCGGCCGGTGATGAACGAGTACATCGAGAATCACTTTGCGGCTGCTTTGGTTTAC
          AAAGGACTCATCACCTCAGTGGAGCACATGGCCGTGTTCATGACCAAGGCAGAGCACCCCGACCCATTCCAGAAGTGCTT
          CGGTTCCCTGGAGTACATATTCAAGTTGCTAATCCAGTCGAGGAAACTGTTTGCCAGGGCAACAGGTGGGCAGTATGAGG
          ACTCGTTCAAGCGGGACCTACACTCCCTTTTTACGGCCCTGAATGGAATGCTAGCTGTGCCCTCGTACGATGTCATCATC
          CCCACCCAGGAGGCCCTGCTTAATTCGACGGGAGTGGTCCTGGAGCAATTGAAGGACACACTCCCCGCTCCGGAGTTGGG
          CATGCTGGCGCGCAATATGCTGGACGCCATTCCCCGGGGAGCTCCCATTCGGTTAATTCAGGCAAAATTGCATGCTGTCA
          AGGATCTGGTGTCTGGGGAGCTGTTCCACGAGGATGATTCCCGCACTGTGGTTCTCTCGGTGGCCTGCAAGCATCTGCGC
          ATGCATCTAAGTCGCCGCGATGAACTGCGTCTGTGTGCTGAAATTCTCTCGGAGATTCTTAGCCAACTGTACGATTTACA
          GAAGGAGCAGCGCGAGAAGGTGACCAACACCTTACAGCACGATCTGGACTCTCTGTGCAAAAATATACTGGGCATTCTGA
          TTCGTACTATAAGCATAATAATGGAGGGATCCAATGCAGTGCTGCCGCAGTTGGTTTCCTGTCTCTTGGGCTTGCTGCAG
          CTGCTCGACGAGACCCACTACAAGCGCTACTGGGACGAGCTGAGTCCCAACAAAGATCCGCGGGATCTGAAGGAGTTCCT
          GAGCAAATCACTGCTGGTGTACGAAGAACTGTTGACACAGGACTGGCATGTGTTCCCCAACGATTGGCTGGTAATGAAGC
          TTGCCGCCAACGATGTGCTGCGCATGTCGCTGGAGGAGTTCGCCAAGCCTCTGGTCTACCGATTCTTGGGTCCCCAGGCA
          TTCGATTCGCAGCTCTGGTGGAGCTACTTCAGTCTGGCTGTTGCCTTCTTGACACAGCCCTCCCTGCAGTTGGAGCAATA
          TAGGGAGCCCAAGAGACTGAAGATACTCCACTCGCATGGAGACATGCGGGTGCTCATGGGCTTCCAGATACTCAGCATGT
          GGTCGCAGCTGGGTGAGCAGAAGCTGCACTTTATTCCATCTATGGTGGGTCCATTCCTGGAGGTCACTTTGGTACCGGAG
          CCAGCTTTGCGGAAGGCCACACTATCGGTCTTTTACGACATGATGCAGTGCGAGCAGGCTGCTCGTGGTTCGTTCCGCCT
          GGTGGAGAGCGAACTGATTGACAAGCTGGACCTGCTCATCAGCGAGAACAAGGGCGACGACGAGTACAGGGAGCTGTTCA
          GCACCATTTTGCTGGAGAAAGTCCAAGTGGAGAACCCCAACTGGAAGGAGGCTGGCATCGCTTTCATAGCCTCAGTCACC
          AGACTTTTGGAGCGCCTTCTGGACTATCGTAGCGTAATGCAGGGCGAGGAAAATCGGGATAAGCGCATGACCTGCACAGT
          CAATCTCCTTAATTTCTATAAAAACGAAATCAATCGAAAGGAGATGTATCTGAGATACATTTACAAGCTGCACAACCTGC
          ACCTGCAGGCAGAGAATTACACAGAGGCTGGCTTCACTCTGAAACTGTATGCATCCATGCTGAGTTGGGATCGTGAGACC
          CAGAGCTTTGCCCCCTTCGATAATAGTGGTCAGCCAGAGTGGCAGCGCAAGGAGCGTCTATACCACGAGATCCTAAAATA
          CTTCGACAAGGGAAAATGTTGGGAAAAGGGCATTCCACTGTGCAAGGAGCTGGCTCATTTATACGAAACGCGGCGTTTTG
          ACTATAACAAGTTGAGTGAAATACTCATTCAGGAGGCCAAGTTCTTCCAGAATATCCTAACTCAGTTGCGACCGGAGCCG
          GAATACTTCCGTGTGGGATTCTACGGAATGGGTCTGCCACTTTTTGTGCGGAACAAGCAATTTGTGTACCGTGGACTGGA
          GTACGAGAGAATAGGAGCCTTCACACAGCGTCTGCAAACGGAGTTTCCTAGTGCTCAGATCTTGGGCAACAACAGTCCGC
          CGGACAACGCCATTCTGAATGCTCCGGATCAGTACATACAGATCAGCAATGTAAGACCTGTTGGGGATGCACAGGCCTTG
          AAGACCGCAATGGTTCCTGTGCCGGAGAAAATAGCTCGTTTCTACGAGGTCAACGATGTAACCCGATTCATCTACGATCG
          CCCCATGTACAAGGGAACAGTTGACAAGGACAATGAGTTCAAGTCGTTGTGGATAGAACGCACTATTCTAGAGATAGCTA
          GTCCACTGCCAGGTATTCTACGCTGGTATGAGGTCAAACAGAAGACGATGCAGGAGTTAACGCCGGTAGAGTACGCTTGC
          GAGATTATCAGCAACGCTGGCAAGGAATTATCCGAGCTGATTGTGCAATATAAGCGCGATCCCAAGAGGAATATTAATCC
          CTTCTCCATGCGTCTGCAGGGCACAATCGATGCTAATGTCATGGGGGGTATAAGCAAGTACCAGGAGGCTTTCTTCTCCG
          AGCAGTTCCTCAAGTCGCCGCAAGGTGCTGGACAGCAGGCAAATGTGCAGCGGCTGAAGGTTCTGATACTGGAGCAGATT
          CAGATATTGGAGCAGGCCCTCGAACTGCACGGTCAGCTAGCGCCCAGTGGTGTCCAGCCTCTGCACAATCGTCTTTTGGA
          ACGCTTTTCCCAGCTTAAGCAAAGTTTATCCGGCATGGGCAGACTGAAACGTCAGCACTCCGAGAGCATTGTAAATACTC
          CCTTGCCACCGTTGCCTACAGAGCAGCGAGTAGCCCCGGCGACAGCTTCCTCAAGCTTGAATGCGAATGCCCACTCCAAC
          TATGTATATGATCTAGATGAGATCTACACGAGACCGGGAGACACTGTACGACCCGTGGACCCACTCAGCTCCTATCAAAC
          ACTGAGCAAGGAGAGTCTTAGTATTCCTCTGGAGGATACTGCTGCTCCTCCAGTACCAAATCGTCCTCGCTCGCAGAACT
          TTATTGGAAACGGATCCATGGACAGCCCGGAGGTTCCGCCGAAACGACAGCCTACATTGAATTCTCCCAATGCTCCTCCG
          CTGCCTCCGCGGGGTATTACACCGGACAAGAGGGCGTCAAATCCGTTGATTTTCAATGACTTCGGCTCCGGAGATGCCGT
          GGGACGTCGGCATTCTCAGCAGCAGCAGCAGCATGGCCAGAAGTATTCCGTTGTTGATATTAGCTACGATGATCCAGAGG
          CAGATCAGCAGCCGCATTCGCTGCCGCCAAACTTCCAGGACGGAAGCGGTGGACACCTCAGCGTCTGTTTTGCCCCGAAT
          GATTTCCGGGACTCCGGCATATCGACGACTAGTTCTAGGGAACTGAACCACATGAATCTTAACAACCTGAGCGAAGACTC
          ATCGTCGATCTCGACCATTACAGTGCAGCATCGAGAACACTGTCGCATCAGCAGCAATGGCAGTTTGGACTATAATGCCG
          CAGCATCAATGAACATTACACAACGAGAGAGTTCGACGAGTTCGTTTGATGTGGAGGACTTTCCAGTGCCGCCGCCGCCC
          ATTCCACCCAAATCCTTGGCAGTGTCAAGCAACGGTGTCAACTTTTCACTCGACGAGGCCCACTCACCGCATCCCAGCAC
          ACAAGCGAACACCACACAACTCAATCACATTCAGAACCCAAATCAGAATCATTCCACAAACAGTCACCATCATCTTCAGC
          AGCAGCAGAATGGAGATGGCGATGGTTATAGCACGCTGCAGCACCCGATGAACGGGCTGGGGCTGCCTACCCTTCCACCA
          CCACCTTCTGCTGTTGAATCGCCAATGCCGGCATCTGCAATAGCCTCATCCACATCTAGTCATCAGCACGATGGCGGCAC
          TTTTTGAGTTACAATATGTCGCTGCCATCATCCACCCGATCAGCCACATCAGCCACACAAGCCATCCTCATCCACGTCAA
          CCTCGGACAGCACGGCCACGGATACGGCTTCGGAATCCACGGAATCCAGTTCGTCTACCCATTCGATGACGCCGCCACCG
          CCTCCCCCACCGCCGCCATCGTCCTTCACGCACTTGCACCATCAGATGGCAGCAACAACTCACTATTGCCAGGATTGTCT
          GTCCTCGCCATCGCCACCACCCACAATCATCACAGAGCAGGCACAAGTGCATCCCACTCCGGGCTCGACCTCAGCACAGC
          CCCACATCGAGCACTGCTCTTGTGGATTGAGTTTCTCCGTGGTTCAGGATCAGCAGGAGCAGTTTCCCAGGCTACTCTCC
          ACCAGATTTTCAACGCTGGAGCGGCAGACCGATGGTTTTCAGGTGGAGCAGGTGTCTGGCTGCCAGCATCATCATCATCA
          CCAGCATAGCCCGTTGTATCATCTTCCTCAAAGCAGTCAGGATGCACATGCTCAGACGGATTTTTCCTACGCGCAGCGCT
          GA
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0330304
          7513
          FBtr0330305
          6710
          FBtr0336765
          7249
          FBtr0336766
          8052
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303335
          2002
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0303336
          2187
          FBpp0303337
          2008
          FBpp0307741
          2008
          FBpp0307742
          2002
          Comments
          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG31048-RD
          spg-RD
          Secondary FlyBase IDs
            References (0)