General Information
Symbol
Dmel\mtd-RY
Species
D. melanogaster
Annotation Symbol
CG32464-RY
FlyBase ID
FBtr0308581
Feature type
Associated gene
Evidence Rank
Length (nt)
4905
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 68 )
Sequence
ATCAGTTTAAGTTTTCCATTTGCACCGAACGCAACGCAAGTAGCTCCCACAAAATCGGAATCAGCCGAAACGAAAACGGA
ACACAAATAACAGAACGCGCGCGCTCAAAGTCAGTGCTTGATACTAAGATATAGCACAGATATACTACATACATATGTAT
GTGGAGCATCGGCGATAAATATTAATATACAAGTATAATTGAAAATATAAGTGTACGCGAGTGCCAATACTGTGAAATCA
ATACGAATGAGAAATGTGACTAACCAATCAAAGGAAAGCAATTGTGCCAAACCTCGTTGAAAGACAACAAATTAAAAAAA
GCGCCTAACGGCTAACGGTTAACGGCTAAAGTTAGCAGTTAGTACCCAGTTACCAATCTATCCGCCCGACCAGCGCCCTC
ATCCGAATCGAGAACCGATCCCCACGCCATGAGCATCATCGACAGCGGCAAGTACCGCTTGCGCAAGGACTGGGCCAGCG
CTTCCATCCCGTCCTTGGTGAACATCGACGAGCACGACGGCGACTCCGGCGACACCGAGGGCAGCCTCAATGCCACGGCT
CCACTGCCACCACAGAAGCCCCCGCGGCGCAGCTCCCTGGCCCTCGGACTGTTCTCCAGCAAATCCGATAAGAGCCAGAA
ACGCCGCAGCTCCATAGCCGTCTCCTTCCTGCGGCGGGATAGTAGTAAGAACTCCACCAAAGACTCGTACGAATCGGCTG
TGCGCAGCGAGAAATCTGACGGATCCGGCACACCCACCAGTCCGGAGATCGTGTACAGCTCCGAGGAGAATATCCGTGCC
AGCTCCCCCAACGATCCGGGCAAGCAGACCTTCTTCGAGGACGGCAGCCAGTCGCCGCGTCCGGTGCTCCAGGGGCTGAA
CACCTCGTACGAGGGACCCCAGAATGATCGACAGAGGCGCAGGCGCAGCTCGCTGCAGACCAAGCTGGACCGGCATCGCC
GCAAGAAGATGGAGTACAGCAACCAGAGGAGCCTGGACTCCGGCATGATGTGCAGCGAGTCCCATAGCGACCTGACCAAC
GACAGCTTGGCCGAGGGCTCCGGCAGCTTTGCCAACAGAAGTCGCAACGGCAACGACGACGAGGACGACATCATCGATCC
CAGCCACGGGGAGTACTTTCCGCGCGAGAAGCGCCACTCCTGGTGGAACATCTTCGTGCCCGACAATTTCAAGAACAGGA
GCAAATCGCGCAGCGTGGATCACGGCCTTGCGGCTCCATTCGACTTGGACTCGCTCCGCTCCAAAGTGGAGCAGCGCTTC
GAGAGCGTCGACAAATTATCAAACATACTCGAGGGCCTGCGCCCCGGATCCCCAAAACCGGGACACATCGAGCGCGTGGG
CGGCAGTAGCCAGCAGCAGCAGGCGGAGGAGGAGGCCAACAAAAGCGACGATCCGGTGATCACACAGCGCTTCCTCAAGA
TCAATGTGCGCCACATCACGGACGGACAGGGCGTGGTGGGCGGCGTCCTGCTGGTCACGCCCAACGCCGTTATGTTCGAT
CCCAACGTCAGCGATCCCCTGGTCATCGAGCACGGCCCGGAGAGCTACGGCGTCATTGCGCCCATGGAGCTGGTGGTCAA
CGCCGCCATCTTCCACGACATTGCGCACATGCGAGTGGCCGGAGGAGCAGGTCAGGGCCTGAACTCCGCCTCGGGAGACG
CGGAGAAACCGGAAATCTACTATCCCAAACCAGTATTAGTCGAAGAAGACTCCAAGGAGCTACCCGAGCAGCAGTCGCTG
CTGGGCGAAGACGGTAATAAGCGCTTAGATGCAGAAATAGGGTCGCTGGAAATCGCTGACGACCAAGAGTCGCTTTGCTC
CAGCACTGGACGCGATGGCGACGCGTTTCCCAAAGCCTTCGACCGCGAACGTGTGGAGGACTCTTCTATGGAAGCCAAAG
ATAGCGCTAAGACTGACGCTCTAGACGATGAAGACAAGAAGGCCGGCCTGGGCCTCTCCAGCACTCGCTCCACCCTCGAG
GAGCGGCGCAAGAGTTTGTTGGATCACCACTGGGCCATTCCGAGCAAAGACCGCTATTGTTTGTCTAATTCCCGAAGATC
CTCGGAAGATGAGGGCGACAACGAGTCAAACGTTACCGTAGACAGTGGCGCACGAGTCCAGGATCCGCACTCGGCCAATA
GTTCGGTCAGCGGCGTGCCGCTTAGCCAGCCCCCTGTGGCTGCTGCTGCAGCTGCCGCTGCCGTCGCACCCGCCTCCGCC
GTCGTTCCTCTGCCTCCCTCGGGCATTGATCTGGAGCACTTGGAGCAGCTGTCCAAGCAGTCGTGCTACGACTCGGGCAT
CGATATCCGCGAGCCCGTTCCCAACGTACAGCCGATACCAAAAAAAACCGTCTACAGCGACGCGGACATTGTCCTCAGCT
CCGACTGGGTACCACCGAAAACCATTGTGCCGACGCACTTCAGCGAGTCCCCGCCGCGCAGCACCATCCTCGGCCAGAGT
CTCGACGCCGGCACAGGAGGCGCAGGGGGCGTCCGTAAGAAGACCTCAAGCGTGAGCTTCAGCGTCGACGACGAGGCCGC
CCAGCAGGCTCAGGCCCAGTCGGCTGCACTGGCTGTCACAGACAAGCAGGCCGACAAGAAGAACAAGATGCTTAAACGTC
TCTCATACCCCCTGACCTGGGTGGAGGGCTTGACTGGGGAGGGTGGTGCCGTGCCGCCCGGCGGCGTGGGCAGTGGAAGC
CTGAACAAGTCGGGAGACACAGACTCGGCGCCCAACACGGGTGACTCCAACCAAAGTGTATTTTCGAAAGTATTCTCAAG
ACGTTCCTCAATCGGTACCTTTATTCGTCCTCACTCCTCGGAGGGCACTTCGTCCAGCACCAAGCTGAAGGAGGCCAAGC
AGGCGCCCAAGTTGGACTACCGCTCCATGGTCTCCATGGACGACAAGCCGGAACTCTTTATCAGTGTGGACAAACTCATC
CCACGACCGGCTCGAGCCTGCCTTGACCCACCATTGTATCTACGCCTGCGCATGGGCAAGCCCATCGGCAAGGCCATTCC
GCTGCCAACCTCTGTCATGTCCTACGGGAAGAACAAGTTGCGCGCTGAGTACTGGTTCAGTGTGCCAAAGAATCGCGTTG
ATGAGCTCTATCGCTTCATAAACACCTGGGTGAAACACCTGTACGGTGAGCTGGACGAAGAGCAGATCAAGGCGCGTGGC
TTCGAGCTGATTCAAGAGGACACCGAGTGGACCAAGAGCGGCACGACCAAAGCCGGCATGGGAGGCGGTAGCCAGGATGG
CGAGGAGATTAGCGACCTGACCCGCGAGTCCTGGGAGGTGCTGTCAATGAGCACAGATGAATATCGCAAGACCTCGCTCT
TTGCCACCGGTTCCTTCGACCTGGACTTCCCCATACCAGACCTGATCGGCAAGACAGAAATCCTTACAGAGGAGCATCGC
GAGAAGCTCTGTTCACATCTGCCGGCTAGAGCCGAGGGATACTCCTGGTCCCTGATCTTCAGCACCTCACAACATGGTTT
CGCACTGAACTCCCTGTACCGCAAAATGGCGCGTCTGGAGAGTCCAGTTCTGATTGTCATTGAGGATACGGAGCACAACG
TATTTGGTGCCCTCACCTCCTGCTCACTGCATGTGTCGGATCACTTTTACGGCACCGGTGAGTCCCTGCTCTACAAGTTT
AACCCCAGCTTCAAGGTGTTCCATTGGACTGGCGAGAATATGTACTTCATCAAAGGAAACATGGAGAGCCTTTCGATTGG
CGCTGGAGACGGTCGTTTTGGCCTGTGGCTGGATGGTGATCTGAACCAGGGACGATCGCAACAGTGCAGCACATACGGCA
ATGAGCCTCTGGCGCCACAAGAAGACTTTGTTATCAAAACACTCGAATGCTGGGCATTTGTTTAAGTGAATTTCTGTTGT
CGACAACAAACATATTTAAGGATGGGAGCGAGGGCCTCCTGCCGACCTATCTATTTAATTAACTATATGTACTTGTACTA
AAAACCAGCAACCTGAGAAAGATGTCAAAAGCTGGTGTGCGTCCAAGGATCATCCCTTCGGAACGGTCCACACAGCCCGA
ACCCCGAAACACTTGAATACACGAACACCACCACATGAAGATGGTTTTGAAGGGATCTGATCTGAAGAAAAATGCTTGTG
AAAACTCCGTTCTCTGAAGCAACTGCGAGTTAGCTATGCGTTGGAACGTATTAATTATTTAGTTTTTATATCATATATTA
TTAAACAAGAGCAACTAAATTATGTGTTAGACTTAAACAAAACAAAACAGAATATGAGAAAACCCAAGAAACAGACTAGC
GACACAAAAACTTAAGCGAAAAGAAATGAGGATAACATTTGAGGGCATCACACATCTCCATGAAAAACATGGCACACGCA
TACACCCACATACGCCTACATTAAAAAACACACATTATGTTTAGTTCTTAATACCGAAAATTATAAACACCAAATTGTGA
GAAGAGACATATTGAAAATAGGCAGATTTTTATCATTTATCGTGTCCAGTTCTCTGGATTGATTTCAGTTTGAATTTAGT
TTCGATTGTTTGAGTTACTAGAGTTATTTGAGAACATTGTGAAAAGCGAAGCGAGCTGAGATGAGAAAAATAAAAAGAAT
GTCGATATAATTTATAGTGCAAAAGTGCTGATTGCAAGTAAAACTAAAGCGAAGATAACTTTAAACGATTTGACTTTTAT
GTATATGTAAAGAAGGAGCCGCGAAGAGCTGAGAGCGAGCGTTTTATTTTTAGTTTTACACGATATACATACATACATAT
ATTTAATTACGATTATTTTAATGCTAATGATGTTGACTTTTATGCAATTATACTAAAACAAAAACAGAAACAACACCAGA
ATGAAATACACAATATTATACAACC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0078817
4719
FBtr0333695
3789
FBtr0078810
8072
FBtr0078815
2303
FBtr0078813
3783
FBtr0078818
4780
FBtr0078816
1675
FBtr0078814
4838
FBtr0078811
5167
FBtr0078812
4502
FBtr0100197
4083
FBtr0100199
5214
FBtr0110932
4332
FBtr0110933
5373
FBtr0273430
2394
FBtr0273431
4175
FBtr0273432
4651
FBtr0273433
5170
FBtr0273434
5169
FBtr0306694
5689
FBtr0306695
6314
FBtr0308580
5976
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0300805
1158
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0078460
210
FBpp0305848
871
FBpp0078453
1270
FBpp0078458
267
FBpp0078456
869
FBpp0089229
1033
FBpp0078459
192
FBpp0078457
213
FBpp0078454
1270
FBpp0078455
1055
FBpp0099567
1012
FBpp0099569
1270
FBpp0110232
1025
FBpp0110233
1314
FBpp0271938
192
FBpp0271939
789
FBpp0271940
1106
FBpp0271941
1106
FBpp0271942
1246
FBpp0297633
1344
FBpp0297634
1180
FBpp0300804
1127
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
l(3)82Fd-RY
mtd-RY
Secondary FlyBase IDs
    References (0)