General Information
Symbol
Dmel\RpS3A-RF
Species
D. melanogaster
Annotation Symbol
CG2168-RF
FlyBase ID
FBtr0308296
Feature type
Associated gene
Evidence Rank
Length (nt)
1349
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 970 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    Sequence
    CGACCTTTTCCGGTTTATTAGTTGAACATGGCAGTCGGCAAAAATAAAGGTCTTTCCAAGGGTGGTAAGAAGGGCGGTAA
    GAAGAAGGTGGTGGACCCGTTTTCTCGCAAGGACTGGTACGATGTCAAAGCTCCGAATATGTTTCAAACCCGTCAAATCG
    GTAAAACACTTGTAAACCGCACCCAGGGTCAAAGAATAGCATCGGATTATTTGAAGGGTCGCGTTTTCGAAGTGTCTTTA
    GCAGACTTGCAAAAGGATATTGATCCAGAACGTTCTTTTCGCAAGTTCCGTCTTATTGCAGAAGATGTTCAAGACCGTAA
    TGTGCTCTGTAACTTTCACGGAATGGACTTGACTACGGACAAGTACAGGTCGATGGTTAAAAAGTGGCAAACACTAATTG
    AAGCTATTGTCGAAGCAAAGACTGTAGATGGGTACCTCTTGCGAGTGTTTTGTATCGGATTTACTGCCAAGGATCAGCAG
    TCTCAGCGCAAAACATGTTATGCTCAGCAATCGCAAGTCCGAAAGATTCGTGCTCGCATGACCGACATTATTACTAATGA
    AGTTAGTGGTGCCGATCTAAAGCAGCTTGTTAACAAGCTGGCCTTGGACTCGATTGCGAAAGATATCGAAAAAAGCTGTC
    AGCGCATATATCCATTACATGATGTTTACATTCGTAAAGTAAAGGTATTGAAGAAACCGCGCTTCGATGTCTCAAAGCTT
    CTGGAATTGCATGGCGATGGCGGTGGCAAATCCGTGGAAGCCGTTGTTTCATCCGAGGGAGCCGTAATCGACCGCCCTGA
    AGGTTATGAGCCCCCAGTACAGGAAGCTGTTTAAATTAAATATGAAATGCATATTTTTTTATGTATTGCATTCAAACATA
    AAATACATTTCTCTACAAATTGCATAAACTATTTTCTTGGCTTGTTATATTAGTTTGTGGGCCTTTGGGAAGTCTTTCGT
    CTTTTAGGCATATGTTTGTTCCAGCCGTCCATCCTGAATGTGGCTACGTTTCGTAACGATCGAGGTGTATACAAAGAAGC
    CGAAATTCACAGGTATGTCGATTGAATAAAAATCAATATATACCCCAACTATGTAAGCATGTCAAACACTTTGGTGGATT
    CCATTTCCAATACTACTGGAGATGGCGTGAAGACGACTACGATATATACAAGGAAATTTTAAAATAAGCTTGGTTGTCCG
    ATTAATCCAAATGAAATGAAAAATCAAAAAAAATTTAAAAATATATGGTTTACTTACATATGTAACTTTATTTTGAATAT
    GACATTCACATAGGCATGATACACGATTTTATTTGACTATAAAATTAACTAGCTAAGTAACGGGTAAAT
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0089175
    910
    FBtr0089176
    854
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0300615
    268
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0088242
    268
    FBpp0088243
    218
    Comments
    Extended 3' UTR based on RNA-Seq and/or EST data.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    RpS3A-RF
    Secondary FlyBase IDs
      References (0)