General Information
Symbol
Dmel\ci-RC
Species
D. melanogaster
Annotation Symbol
CG2125-RC
FlyBase ID
FBtr0308074
Feature type
Associated gene
Evidence Rank
Length (nt)
4874
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 97 )
Sequence
AAGCATTGCAACAGCTAGTGTTAATGTCGCTCAGTCCACTCGTAAGAAACATAGGAATAAGACGCAGCATTCAAAAAATA
TTGACTTGTCTTACAAAACTGATTTTCATTGTTCGCTACTTAATATTTAGTGATAAATATATTACTTCGGGACTGATAAT
CTTATGAATATACGTGTGAGATTTGGCGATACCCTTCATTACTTAGGAAGCCGAGCGCATAAGCTCACACCATTATAATA
TTTAAGTGATATGAATATTAAATATTAAAATTTAAAACCAACTTTTTAATCAAAGAGTTTCCTTAAAATTGTTTAAGTTG
CCGATCAAAAGTGGAAATTTATGCGTGCCGTTATTTGAAATACCAATCTTTTGAAAATGTTTACGCCGACGGTTAATATT
ATTTAAAAGGATAATTGAATTTATAAAACGACGTCATTCTTGTTGTGGACTAACTTTAATGAAATGGACGCCTACGCGTT
ACCTACATATTTTCCTCTTGCGTATTCTGAATTGCAGTTTTTAGCGTCCAGGAGAGCAGCTGCCGTCGCTGCAGCGGCTA
CTGTTTTACCAGGATCACCATGCATAAACCAACATCACCCAACTGACGTTTCAAGCTCGGTAACAGTGCCATCAATTATT
CCAACGGGTGGAACATCAGATTCAATTAAAACTTCAATACAACCACAAATATGCAATGAAAACACCCTTCTTGGAAATGC
TGGCCACCAGCACAATCATCAGCCTCAACATGTTCACAATATAAATGTTACTGGACAGCCACATGACTTTCACCCGGCCT
ATAGAATTCCCGGATACATGGAACAGTTGTATTCTCTTCAACGAACTAATTCAGCTTCATCTTTTCACGATCCCTATGTC
AATTGTGCATCAGCATTCCATCTTGCCGGACTTGGTTTGGGATCAGCTGATTTTTTGGGCAGCCGAGGTTTGAGCTCTTT
GGGTGAACTGCATAATGCTGCTGTGGCAGCAGCAGCAGCCGGATCTCTCGCAAGTACTGATTTTCACTTCAGTGTTGATG
GAAACAGGCGGTTGGGTAGCCCTCGACCACCAGGAGGAAGTATACGTGCCAGCATAAGCCGCAAACGAGCACTTTCGTCA
TCGCCTTATTCCGATTCATTTGATATTAATTCAATGATTCGATTTTCGCCAAACTCTTTAGCCACAATTATGAACGGTTC
TCGAGGAAGCAGCGCGGCTAGTGGTTCTTACGGTCATATTTCTGCTACCGCCCTTAATCCCATGTCTCATGTTCATTCAA
CCCGTCTGCAACAGATACAAGCTCATTTATTGCGTGCAAGTGCAGGTCTGTTAAATCCGATGACACCACAACAAGTTGCT
GCATCTGGATTTTCTATAGGGCATATGCCAACCTCTGCTTCTTTGAGAGTGAATGACGTACATCCTAATCTAAGCGATTC
ACATATCCAGATAACAACATCCCCAACTGTTACAAAGGATGTAAGCCAGGTCCCAGCGGCAGCATTCTCGTTGAAGAACT
TAGATGATGCAAGAGAGAAAAAGGGACCCTTTAAAGATGTTGTCCCCGAGCAGCCTTCATCGACATCTGGCGGCGTAGCA
CAAGTAGAAGCCGACAGTGCGTCTTCACAGTTGTCTGACCGTTGTTACAACAACGTGGTAAACAATATTACAGGCATTCC
TGGTGACGTTAAAGTAAACAGCCGCTTGGATGAGTATATTAATTGCGGATCAATTTCGATTCCGTCAAATGAATATGATT
GTGCTAATGCTGATACTACGGATATCAAGGATGAACCCGGAGATTTCATTGAAACAAATTGTCATTGGCGTAGCTGTCGC
ATTGAGTTCATTACGCAAGATGAACTTGTTAAACATATAAATAATGATCATATTCAAACAAACAAGAAAGCTTTTGTCTG
TCGATGGGAAGATTGTACACGCGGTGAAAAACCATTTAAAGCGCAGTATATGCTTGTTGTGCATATGCGGCGTCATACCG
GTGAAAAGCCACACAAATGCACGGAGAAAAACCATACACTTGCGAGTATCCGGGATGTAGCAAAGCCTTTAGTAATGCTA
GTGATCGCGCAAAGCATCAAAATCGAACACACAGTAATGAGAAACCGTACATTTGTAAAGCACCTGGATGCACAAAACGT
TACACCGACCCGAGCTCTTTGAGAAAACATGTAAAAACAGTCCATGGAGCTGAATTTTATGCAAATAAAAAACATAAGGG
GTTGCCTCTAAATGACGCAAACTCTCGGTTACAACAAAACAACAGTCGGCATAATCTTCAAGAGCACAATATCGACTCAA
GCCCTTGCAGTGAAGACTCACATTTGGGAAAAATGTTAGGCACGTCTAGTCCTAGCATTAAATCTGAATCAGATATAAGC
TCATCAAACCATCACTTAGTAAATGGAGTTCGAGCATCTGACAGTTTGTTAACATATTCACCTGATGATCTTGCTGAAAA
TCTTAATTTGGATGATGGCTGGAATTGTGACGATGACGTGGACGTGGCAGACCTACCAATTGTGTTACGTGCTATGGTAA
ATATTGGTAACGGAAATGCATCCGCCTCGACTATTGGAGGTTCTGTTTTGGCTAGGCAACGGTTTAGAGGTCGTCTTCAA
ACTAAAGGTATAAATTCAAGTACGATTATGCTTTGCAACATTCCAGAAAGCAATCGTACCTTTGGAATTAGCGAACTTAA
TCAGCGTATTACAGAACTGAAAATGGAGCCAGGTACTGATGCTGAAATTAAAATTCCTAAGCTCCCAAACACGACCATAG
GAGGATATACGGAAGACCCTTTACAAAACCAAACAAGTTTTCGTAATACAGTATCGAATAAGCAAGGAACTGTTTCCGGA
TCGATACAAGGACAGTTTCGTCGCGATAGTCAAAATTCCACTGCAAGCACTTATTACGGTAGCATGCAAAGTCGTCGTAG
CAGTCAATCATCCCAGGTGTCTTCTATACCTACCATGCGACCGAACCCCTCGTGTAACTCGACTGCATCCTTTTATGATC
CCATTTCACCAGGGTGCTCACGGCGCTCTAGCCAAATGTCAAATGGTGCTAACTGCAATTCATTTACTTCCACATCAGGA
CTACCCGTATTAAATAAGGAATCGAACAAAAGCTTAAATGCATGTATTAATAAACCTAATATCGGGGTTCAGGGTGTTGG
AATTTACAATAGCAGTCTACCCCCACCTCCATCGTCCCACTTAATTGCAACAAACTTAAAGCGCTTACAGCGGAAAGATT
CAGAATATCACAATTTCACTAGCGGGCGATTTTCTGTTCCTAGTTATATGCATTCTTTACACATAAAAAACAACAAACCA
GTCGGAGAAAACGAATTTGATAAAGCAATAGCGAGTAATGCACGACGTCAAACTGATCCAGTGCCAAACATAAACTTAGA
TCCATTAACAAATATTTCTCGGTTCAGTACAACACCGCATAGCTTTGATATTAATGTCGGAAAGACTAATAATATAGCAT
CGTCAATTAATAAGGACAATTTAAGAAAGGATCTGTTCACTGTTTCAATTAAGGCTGACATGGCAATGACTAGTGACCAA
CATCCAAATGAAAGAATAAATTTGGACGAAGTTGAAGAACTTATACTTCCCGATGAAATGCTTCAGTACTTAAACTTGGT
AAAAGACGACACAAATCATTTGGAAAAAGAACATCAAGCTGTACCTGTGGGGTCAAATGTATCCGAAACTATAGCTTCAA
ACCACTACCGAGAACAATCAAATATATATTACACCAATAAACAAATTTTAACACCGCCTTCTAACGTTGATATACAACCA
AATACAACAAAGTTTACAGTACAAGACAAATTTGCTATGACGGCGGTCGGGGGTTCATTCAGTCAAAGAGAATTAAGTAC
CCTAGCTGTACCAAATGAACATGGGCATGCCAAATGCGAAAGCTTCCATCACCAGTCTCAAAAATATATGAACACTGACA
TTGGCTCCAAGCAGCAATCAGCATTACCGTCAGCTCATCAACGGCAAACAGAAAAATCAAATTATAATCAAATCATAGAC
TCATCGATGACTAGCTTGCCAGAACTTAATGTAGATTCAATATATCCACGAAACGAAACAGAAAATATATTTAAAGTACA
CGGAGATCATGATAATGAAATCCAATGCGGCATTATAAGTCAATCTCAAATGTCACCTTCCACTAATTTGAATAATGATG
GTCAGTTTTCTACCGTAAATATGCAACCAATAACAACATCCAAATTATTTCCCCCTGAACCACAAAAAATAGTTTGTGAC
ACCCAAGCGAGTAATACTTCGGTTATGCATTTAGATACATATCAGCGTACTCTGGAATATGTACAAAGTTGTCAAAACTG
GATGGAGACGAACAACACATCTACCAATCAAATACAAAGCCTCCCGGGAATGCCGGTAAACAATACATTGTTTCCCGATG
TTAGCAGCTCTACACATCCATATCATGGGACAAATATGGTGATCAACGATATGACTACATCCCTTACTTCCTTACTCGAG
GAAAATAGATACCTTCAAATGATGCAGTAAAAAATGTTATCTAGCTAACACTGACAAGAAATCAGTCATAATAAACTATT
TTATTCTATTTAGATTGTATTTACTTTATAGGCAATATACCAATTACAAAACAAAATTAAATTAAAATCCTGATTCAACA
CTGTAATATTTTTTACAAATGTCCTTTAATCAAGTTCATTTATTATTTTACAAAAACGAGAATTTTATTTTAAATATTCT
AAATACATGTAACAATATAATGTCTTCCGAGCTATTTTAAACATTAAAATGCAATGATTATGCTCTTACTAAAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089178
4941
FBtr0306168
5191
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0300417
572
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088245
1397
FBpp0297298
1279
Comments
Transcript terminates at site supported by polyadenylated cDNA.
Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
ci-RC
Secondary FlyBase IDs
    References (0)