General Information
Symbol
Dmel\scny-RH
Species
D. melanogaster
Annotation Symbol
CG5505-RH
FlyBase ID
FBtr0307976
Feature type
Associated gene
Evidence Rank
Length (nt)
4303
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 98 )
Sequence
AAAATGAAGCGAAAAGAGAATCCGCAGTCGGAAGAAACACGAGGGAAGGAATTGCCATTATTTTCGAAAGCAGACTTTTC
GTTCTAAAATGCCTGGCCGCGCACGAAATTGAAACAGATCAATTTGTGAGCGAACGTTTCTTAATCGTAATGCTCAGTAG
GCCAACAGATCGAGATCGCAGCGCGAAAAAGCCAGAAAAAGAAGAGTGCTCCCGAGTGCGTTAGTGTGCGTGTGTCGGTG
TCGCAGTCGGTGTGTGAAACAAGAAGTGTTCGAGAGAGGGGCGAGGAGAAAAGTGAGCGTAGAGCAGTAGGAGAGTTTTG
AAGGACGTGTGGGCTGTGCAGAAGGATCTCTAGTATCTGCTTTGGATCGCACGCCCATGTGCATTAGCTAACTGGGTGGC
GAAAACCACCAACACACGCCACACCACGCCCCTCACACCCGTTCAAAATTCCACCGCAAATCCCCAGCCGGAGCATCGCC
ATGCCCGTTTCGATGGCCGTATGCGAAACGGCGAATGTCGTCAACGCAGCGCTGCGCGAATCCCTTGGCGGCAACTCCTC
CGCCGGCTCGTCGACTGACCAGGCCAAGAGCGGCGAGGACACCAACGGCAGCCTGCAAAATCACATCGTGGCCAATGCCA
AACGCATCCTGATGGCCAAAATCGAATACGAGGAGGTGCCCAACTACCACGAATCGGTGCTGGAGAACCTCAAGTCCAAA
TATATTGTCATCAAGCCGGGAAATCCAGGCGCCATCAATGGCTTTAGTGGCAAAAACAATACAGGCAAACTTGTGGGCGC
AAATGGACATGACAATAACGGCGCCCGCAAGCAAGCGGAGCACCCGAACAATCAGTCGCACCACATCAACCACCACAATC
ATCAGCATCCGACAAGCAATCCCAATGAGCTGCCCAAGCCGAAGAGGGTCCTCTATCCGCGGGAGAACATACGCATTGGC
TGGAAGCAGTCGGAGCGCAAATGGCAGGTGGGCACGGGCATGATCAATGTGGGCAACACCTGCTACCTCAACTCAACGCT
TCAGGCGCTCCTGCACATACCCGCCCTGGCCAATTGGCTCGTTTCGGAGCAGGCGCATCTGGCTGACTGCAATGTGGCCG
AACCTGGCAGCGGTTGCATCATTTGCGCCATGACCAAAACACTTTTGGCCACCCAAAGCAATCAGTCGGCCGTCAGACCC
TTCCTCATCTACTCGAAGCTAAAGCAGATCTGCAAACACATGGTCGTTGGTCGCCAAGAGGATGCGCACGAGTTCCTGCG
CTTCCTGGTCGAGGCCATGGAGCGGGCGTATTTGATGCGGTTTCGTAACTACAAAGAGCTGGATCAGTTGGTTAAGGAGA
CCACGCCGCTGGGACAGATCTTTGGCGGCTATCTGCGCAGCGAGGTGCGCTGTCTGAGCTGCAACCATGTGTCCATTACG
TTTCAGCACTTCCAGGATCTGTTGCTCGACATCCGCAAGGCAGACTCCTTGGAGGATGCTTTCGAGGGACACTTTTCTCG
CGAACGGCTAGAGGATATGGGCTACAAGTGCGAGGGATGCAAGAAGAAGGTATCTGCCACAAAGCAATTCTCTTTGGAGC
GTGCCCCAATCACGCTTTGTATACAGCTGAAGCGATTCTCCATGATCGGCAACAAACTGACCAAGCAGATTTCCTTCAAG
TCACGCATAGATTTGAGCAAATACGCAGCCCGTTCACAAGCAGCTCAGGCTCAACCGCTCACCTATCGCCTGGTGTCGAT
GGTCACTCACTTGGGGGCGTCCCAGCACTGCGGTCACTACACGGCCATTGGCTCCACGGATACGGGCAGCTTTTACAACT
TCGACGACAGCTACGTGCGGCCAATCGCAATGCACAGTGTGTGCAACACAAATGCCTATATAATGTTTTTCGAACTGGAC
CTCTCACAGGCTGCCAGTCCGGCGGCCAACAGGCCCAATGGAGTGCGTTTGACCAACGGACACAGCACAACGCCAGTGCC
GGCGGCGACTGTGTCTTCGCCTTCACCAACGCGTTTCATTGGTCCTCAACTGCCGGCGGGTGGAGCAAACGGTTACACTA
ATGGAAATGCCCAGAAAACCGCCATCCAGTTCAAGCAACAAAACCAGCAAAGTCCACAGAACGGACTCCAGCTGGGTACC
GGAAAGTTTCAGGACACTGCGAAGCCTCCACTGGTTGGCGCTCACGCTAAAGGCGAAGCTACTTCAGCTCCCACTGCAAA
TGGTAACAAAAGTTCCTCCCCAAGCAGCAACAGCAGCAGCAACCATAAATCAATAAACCAGCAACAATATCTGCCAATTT
CCTCGGATGATGAAGACATCGAGGATGAGATGAAGCCCAGACCAACGACAGCCCAGCTACCGAGCATGCCCAATATGACG
GAGAATCATACGGAGCCTAAGGCAAAGTCTCCTGTAAAGATTCAAGTAAAGACTCCCGTCAAAACGCCACTGAAAAGTCT
TGTGCCCTACGAATCAGCATCTGAGGAGGAGGAGGCGCCTCTACCGAATCCCCGCAAGCGTCCAAGTGGGGAGGATTCTA
GCGAGTCGGACCAAGAGTCTGGCCAGACCAATGGTCACAGTAAGACCAATGGCAGCCACACCAACGGCTCAGCCTCGTCA
TCGGTTCACGTTAACAACAGCAAACAAAAGACTGATGCCATAGACGAGATATTCAAGAGCCTAAAAAAGTCCGCAGACAG
TGATGAGGACGACGATGAGGAGGAGCCCAGCATTCAGCTAACGAATGGCTGGCACCCACAGAAGCAATCACAGTCTCAAA
GCAAAGCACCACCATCGCCAAAGACGCCACCCTCGCCAGCGGTCATCAAATCGAAAACGGGTATCTGGAAAGTTACGCGT
AACGATGAGGTCGATGCCATCGAAGATGATGTTGACGTCGTGGTGGTGGAGGGATCGCCGGTGAAAATTCCGACGCCGAA
CAAGAACCATCGCAATCCCTTCTCGAGTAGCAAGCCCTCCACGGACTCGCCCGCAACGCCAGGCGCCAAGCGCCAAAAGT
TGCTCAACGGCAGTGCGCTCAAGTCGCACCAGCAGCCAAGGGTGGGCAATGGCTACCAGAGCAATGCCACCTCGAATGGG
AGCACCATCAATGAGCTGCTGAAGCAATCGTATCGTGGATACGGCTCCCCCGTGCTCAGTTGGAATGGCAAGCCCGCGGA
GCTCGAAAAGGAGACTTTTGAGTTGGTTTGTGCGAAACGGATAGCTGGTCACGGCAGTGTGGAAGGCAGCGATATCGTCG
AGGGCTCGGTTGCAGTCGACGCGGCAGTGACTAGTGGCAGTGACAGTAAAGATGTGGTCGTAATTGCAGTGGCGGTAACA
GACACGACCGCTGACGCACCCGATCCGGATCGTCTCACGGACGGCCGGTAGGAGGTAGAAGCGTCGGCGGCAGAGGCGAC
GCTTCTTCTTTTTCCCCACTAAGCACATACCACACAAAACAAATACAAATAATACGATTACCCCGAATAGTCTGTGATGG
CTGCGTTGCTGGTATCCGTTCCCAACCGGGCGGTCACCACAACGCGTCCTCCGTTCAGCGAGCGTGAAAAGTGTAGAGAG
AGTTGCAAAAGTCATTGCGGGAGAGAGTGACTGCACCGGAGCCTAGCTACTGGTGGATGCGCGTGAGCAGCGGCAGCGGG
ACATCGACGACGACGAAGAGAACGAGATGGATCGTGGACGTCAGCGGAAGGTGAAGTCCGGTTCGGCTAAGGGAAACAAT
GCCAGCAACAGCACGCCCGGGTACAATCCATTCCAGGAGTACGAGGGCCAGAAGCGCTGGAACAAGAACGGCGGAGGTGG
AGGATTTCCGCGATTCTACAATCAGAACTATCGCCAGAACTTCCAGCAGCGCAACAAGTTCAAGTTCAACCGCTTCGGAG
GACCAGGCAGCGCCAAGTTCCAGCAGCAGCGAGCCCTGCAACGACATCTGTCCGCCGGCGGTGGCTTCAGTCGGCGACAA
CCGTCGGCGCAGCAGCAGCAGCAAACCTAACTGGATGCGGATAGGCGAGGGTCAGGAGAAAGAGATGACGCCGATGCGAC
TGCGGCGTGTGCATTTGTTATTGGATTTCAATTTCGCATGAGTTTTGTAAACGTTTTTTAACTGCTGATGATGAACATAT
TAGAAATAGGAGTAGGCGTAGGACTGTAAGCTATAAGCTAGAACATAATTGTTGCCTCCCAAAATCATCCCCAACCTTCA
CCGAAGCACACAGTCCCATTAGAAACTAAGGCTATCATTAAGTACGATAAAAAAAAAGAAATG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0077101
3512
FBtr0077103
3637
FBtr0077100
4417
FBtr0307975
4470
FBtr0330127
3644
FBtr0330128
4538
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0300345
976
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0076807
968
FBpp0076809
948
FBpp0076806
1038
FBpp0300344
976
FBpp0303160
886
FBpp0303161
906
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
scny-RH
Secondary FlyBase IDs
    References (0)