General Information
Symbol
Dmel\mbl-RH
Species
D. melanogaster
Annotation Symbol
CG33197-RH
FlyBase ID
FBtr0306601
Feature type
Associated gene
Evidence Rank
Length (nt)
5257
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 49 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTTTCGAAAAATTTTTCGATGGAAGCGGTTCTGTCAGCGGAAAAGTGAATTATACCAGAGCCTGCCTGAAAAACTCA
          AGAAAACCCCATCAAAGAAATAGCAGCTCTCAGCTAAATAATAACAAACACAATACTTTCTGCTCAGTCACCGCAAACAG
          AAATAATCACAATTCTGCAAAACGCCGTCATCAAAAAAGTTTTAGCCTACAACTCTAGAAACGCGGAAAAATTTGTCAAA
          AATACAACTAAAAAAACAACAACGCGAGTGCACGTGTATGTGAGGTGCTCAGTAAGAGTGTTTGCGTGTGTTCGTTTCTG
          TGTGTGACAGATAATAAAAGGAGAAAAAAAGAAGTTGTCGAAAGTCGTTCGTGAAAATTCAAGAAAAATAGTGCAAGCGC
          TGCAGGGAAATTGTCCGGAAAAATCGCAAAATCCATTGTTTTTAGCCGGCATCTTAAAAACCAACGATAACAACAGCTTC
          TGCAACAACGCGCGTGTTTAGTTCACACACACACCACGGAGCGTCGAGAAAAAAAGATAATGTAAACTCAGCTTACACAC
          AAAAAAGCAGTAAAATATAAAATACAAAAATTAACAGCTGCGTTTATCTATAGATATATATATACACATCTATATATTTG
          AATAAGCGTTCGATTTGAATCAAAATTATAGCCCAAGCTATCAGCTACCCCCACAAGCTTTGTACTCCACAAAAACGCTA
          ACGAGCAAAATCGATAAAGACCAGATAGCAAATGAAATCATACCATCTGCCATAGATCTATGCTATAAACATATATAGGT
          GCTGATCTGTGCTCTTGAATTTAGTGTTTTTTGTGTGTGCGTGTCGCGAGAGGAGCACTCAAAACCAAAAAAAAAAAAAA
          AAACGTATAGTAAAACAAAAAACTATCTCTAGTCGCTAGGCTATAACTATACAAACTCCAGCTATCCCAGATCCAGATCC
          GTAAACAGCAAATAGTTATATATCTATAACCCCAAAATACGATGGCCAACGTTGTCAATATGAACAGCCTGCTCAACGGC
          AAGGATTCGCGCTGGCTGCAATTGGAGGTCTGTCGCGAGTTCCAGCGCAACAAATGCTCGCGCCAGGACACCGAATGCAA
          GTTCGCCCATCCCCCGGCCAACGTGGAGGTCCAGAACGGCAAGGTCACCGCCTGCTACGACAGCATCAAGGGCCGCTGTA
          ATCGTGATAAACCGCCGTGCAAATACTTTCATCCACCACAGCATCTGAAGGATCAGTTATTGATAAATGGACGCAATCAT
          TTGGCCCTCAAGAATGCACTGATGCAACAGATGGGCATCGCGCCCGGCCAACCGGTCATATCGGGCCAAGTGCCAGCCGT
          GGCAACAAACCCCTATCTGACCGGCATTCCGGCCAACTCGTACAGTCCGTACTACACAACGGGACACCTGGTGCCCGCCT
          TGCTGGGTCCGGATCCCGTGACCTCCCAACTGGGACCCGTGGTGCCCCAAACAGTGCAGGTGGCACAGCAGAAAATACCA
          CGTTCCGACAGATTAGAGGTGTGCCGCGAATTCCTGCGCGGCGCCTGCAAACGGGCGGAATCCGAGTGCCGGTTCGCCCA
          TCCGCAGGAGAGCGTCGCCAGGCACGACGACGGCTCGATAACGGTTTGCATGGACGCCGTGAAGGGCAGGTGCGCACGCG
          ACCCCTGCCGCTACTTCCATCCCCCCCTGCACCTACAGGCACAATTAAAAGCGGCCCAAACACGCGCCACCGCTGTCGCT
          GCTGCAGCTGCGACCTCACCTCTTGCGGCACACCATCACCAGCAACAACAACAATTGCAACACCAGCTGAACAACATCAA
          CAACAACAACAACCACAGCACCGCTGGCGCAGCAGCCACCTCGACAACAGCAACAACAACCACAAACAACGCCGCTGCCG
          CCGCCGCCGCTGCTGCCGCCGCCGCTGCCGCCGCTGTCATGGGCCATCACACACTGGAAGTGGGCAAGAAGCGGGCGGCG
          GACACGACCGACATGTTTCCACTGCAATTCTCTGGCATGGTACCGTTCAAACGTCCAGCTGCCGAAAAGTCTGGCATTCC
          AGTTTATCAGCCCGGTGCGACCGCCTATCAGCAGCTAATGCAGCCCTACGTGCCAGTCTCATGTATCATAAACGCTGTTA
          TGGCTTCTACCAATATAACATCATCAGCAACAACAACAGCATCATCATCATTACTATCAGCGTTGGGCACACCACCAACG
          ACAACAACAACAGCCATTACTAATCCTAACGATAGTGATAACGATTCCGATCGCAATCAAGACCATGACAAAAATCACGA
          TAGTACTGCTGATGGTGAAGCTGATAATGCCGATCGCAACGATGCCATTGATCAAGTCAGCAATCAAGACAATAGTGACC
          AAGTGAATCTGAATCAGAATCAGCAAAATTCAAGTCCCGCTAAAGATTGTAATACAACACGAACAATCTCACCAAATCCC
          CAAGACACAGCAGCAACAGCTGCCACTGCAACAGAAACAGACACACTAGATACAGAATCTGCAGCAGCAGCAGCAGCAGC
          AACATCTGCCACCCATCCCCCTGGCGACACACCGCCCCCTTGCCAACGTTCGCCCCAAGGCGATAGTCTTCTCCCCCTGC
          CCAATGGCCTGGGCGATAATAACAATTACTTGTCCTATATCAATAACAATCTTAACAATGGTCAGCTCAAGTCGGCTAAT
          CCCGAAGAATTGAACGGTGGCGACTTAGAGAGTAGCAGCAATAACGCAGCAGCCGCAGCCGCAGCATCAGCATCAGCATC
          ACGTAACTATGCCAAGCAGAATGGCGAGGGATATTCGAGGTATATGGTTAATGGTCATAGCACTGGCATTCTGCCAACAC
          CCACAACTTCTGCTCCGGCAGTTTCCTATCAGGCTCAGGCTCAAGCCCAGGCCCAAGCTCAGGTTCAGGCCCAGGCCCAG
          GCACAGGCCCAAGTTCAGGCCCAGACTCAGCAGCGCATCAACTATGCCATGTCCGCCTATGGTAATCTGTACTCCCACTA
          CGGAGCACCGACCTCTGCCATGGTGAGTCTGCCCAGCAGCACTCCCTCCTACGCCCAGGCTCAAATGCAGCAGCAGCAAC
          AACAGGCGCAGGCTCAAGCTCAGGCGCAGGCTCAAGCCCATGCTGTCTATGCCCAGCAGGCCTACGCCGCCTATGCCGCA
          GCCGGTTTGGCACCTCAGGCCACCGCTACAGGTAGCTACTACGCCGATCCGGCTGCCCTGGCCAAGGAGGTGGCCCAGAA
          AAACTACGCCATGAAGCTGGCCAGTGCGGGCACAAAGCCGGGTGTCTCCTCGGCGGCCGCTGCCTACACCGGCTTGACAC
          TCAACAAGAGCTATGTGGCCGCAGCAGCTGGTGCACAGCCTGTTCAGCCCGCCCAGCATCAAGCCGTTTCCATGGCAACA
          CTACTGCAAATGCAGGCTCAGGCCCAGGCGCAGGCAGCACAAGTTCAGGCCCAAGCTCAGGCTCAAGCTCAAGCTCAAGC
          TCAGGCCCAGGCTCAGGCCCAAATGCGCCAGTTGGGTTCCCTGCCCAGTTCAGGACTAGCGACTCCTGTGCCCGGCACCC
          CAGTGCGTGCCCCAGTCGGTGCCAGTCAGTATCAATCGGCTACGCTATTGAGAGCACCCTCACCTATGCCATATGCGCAG
          CCACAGAGCTACTTCTATCCCGGAATGATGCCCACCGCAGCCTATGCCATGCCACAGACTCAGGCCGCTGCTGCCCAGCA
          ATATGCAGCTGCTGCAGCAGCAGCAGCAGCCGCTCAGGCGGGAACCCCAGGCAGTGCCATGGTCCTAAATCCCTACAAAA
          AGATGAAGACCTCCTAAGAACCCGGGCGATAACAATCTAAAAGTCCAAACACAACTGTACTTAATGCACCAAGCCATCGA
          ACAGATGGAATAGTCACACCATTTTAGATTTATAGATATAAACACATCGAAGACGTAAGAATATGTGCCTCAGTTTTCTT
          TGAAAGGACATGTAGAGAGAAACGTTTAGATCTTAGTTTTACCATAGGCCTCATAGCGTTAGGAAACGGAACCATGACAA
          GATAACTAAAATCCGACAGACAGCGAGACAGATCGAAGATCAATGCTTACTAACCCAAATGCCCAAAACTTGCTGACACG
          AAATCGATAATTTGCCATTAAGTTATTTCACAAACGAAACATAACCTCACTGTGACTCAAGTGTTGCCATTTTCGCAAAT
          GAATCGAAAAACCGAGCTTTTAAAGCACAAGCGAACGGAAGAGAAACAGATGTTAGATGATAGTAATACTTAAGTTCCTT
          TTTTGAATAGCTCTTAGTTAACTCTAGTTTATAGGAAACGGTCACACAAAACGGATAGAAAAAAACTTAAAACGGGGGCG
          GGCCAGAGAAAGAAACGAAGAACTGTGATAGCTAAAAAGCTTTGAGGGATCAAAATCATTAAGCCAGAAAGGAGTTTAAA
          AAAGGATAAACCTCTAATGCTGCTGCCGATGCTGGGTACAGTTGTGTATGCTTGTTGCTAGCTGCGGGTGCTTAATGCCA
          TATTGCCGTCCCTGTCTCCCAAATGCGGTAGTTCGAATAGCTGTCTTTCTCTCGCCCCCGTCCATCATTCATTTTTCGCG
          CTCTCTCTCTCTCTATCTAACTCCCTATTGCTGTTTCTTAATATTTCCTTACTAGCTAGATAGCTAGCGTGAATGCTGTT
          GTAATTGTTTAAAATTGTTGAGCAACGATTATTGCGTAACGAATATTGTCTAGATTATATAGAATACTTATACGATATAC
          AAATACATATAAACCTAGGTGTACGTGCTGTATGCTGCTACCCATATTCGATACAATATATACACCCACACTATGTACTC
          TAACACACGCTCATCCCCCACTAGTACACAAAAGAAAAAAGGCATTATAATGACCAGGATCTATCTGTAAATCGTATGTC
          TAGCTTACTAATCAGATATTACAGTACAGTCACCACTCACGATCACGTCTCTCTATCTGTTTCACTCACACACCAGATAC
          CCAAACACTTTTCAGACTGTTAAGCCAGCAAAATTAATTTATGTTAATGTTATGTTATCGAGATTTAAATTTGATGTGTT
          GACCAGAACTATGTAAACCCTTTTGATTTTCAAAGACTATCTCCATATCCTGATTTCATTTTTCACCTGTTCCTTAACAA
          CTATCACCCACTCTATCGATGTATTATAAATGTTTTCCTTTTTGTAATGGAATTGTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0086991
          2942
          FBtr0086992
          3877
          FBtr0086994
          7500
          FBtr0306603
          4929
          FBtr0306604
          4971
          FBtr0306606
          5023
          FBtr0310058
          7373
          FBtr0310059
          7517
          FBtr0310346
          7651
          FBtr0336940
          5430
          FBtr0336941
          5337
          FBtr0336942
          5379
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0297556
          951
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0086143
          203
          FBpp0086144
          297
          FBpp0086146
          243
          FBpp0297558
          789
          FBpp0297559
          803
          FBpp0297561
          873
          FBpp0301759
          535
          FBpp0301760
          583
          FBpp0302029
          667
          FBpp0307871
          956
          FBpp0307872
          925
          FBpp0307873
          939
          Comments
          3' UTR based on RNA-Seq data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          mbl-RH
          Secondary FlyBase IDs
            References (0)