General Information
Symbol
Dmel\dpy-RJ
Species
D. melanogaster
Annotation Symbol
CG33196-RJ
FlyBase ID
FBtr0305142
Feature type
Associated gene
Evidence Rank
Length (nt)
48068
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTGCGAACTTCAACGTGCGAGGTGTGATCGTCGCTAACGATCTCTGTTCCTTCCTGTGGATTTTATATCTGAGAGACAGA
      GAACGAGAAGTGAAGAAAACTGCCTGAAACCAATATCAGAGTTGGCACAGTACTTGGGTTTTAGTGTGTGTGTGTTCTTT
      CCCAAGTGCCTTGTGCACTCTAAGTACAACAAATAGATATATATATACATATATATAGTGCATATCGTGTAGTGACAAAT
      AATACAAAACATAACTGAAAAGCTACGAAGCCCCCATATCAACCAGGCCGACACGTTTTGCTTTGCGGAGAAATGAGTAA
      CAACAAATTATTGTGAAAGTTGCCGGGCATTTTTCAGCTATTTTACCCTGTGAAAATTCCGAAAAACCAAACGCGCGCAA
      AGCAATCCAAAGTGTTCATAAGAAAAGCGTTTAATATTGTTAAGTACAACAATACGTTTTAATACAAATATTCAAGTGTC
      TGTGAGTCTGCCAAAGTCGTCGCGCAGTGTGTGTGTGTGTGTCTTTCTGCGCTTTTGACGGCAAATCGCTTTTGGCAGCT
      GCTTTGGCAGCAGCCAAGTAAGAAACAAGGCTTTTTTGCTGGCGTCGATCTTCGTTGGCAGCTGTTGGCAGTATGAACTG
      ATTTTGGCCGAAAGTTGATGAATAAAATGCAAAAATGAAAATATTTTTGCCACTAGTCACGTGGATAGTGCTACTACTCT
      CGAGTGCAGTACATTCACAATATTCACAACAACCGCAACCATTCAAGACGAACTTAAGGGCGAATAGTCGGTTTCGCGGC
      GAGGTCTTCTACCTGAACCTCGAGAATGGCTACTTTGGCTGCCAAGTCAACGAGTCCACCGAATATTTGCAGCTATTCAA
      CCTATCGAAACTATGCGACGGTACCCAAGATTGCTTCCTGGGTGCCGATGAGTTGAGCAAAGAGCTCAAATGCACAAATG
      ACTGTGATAAGGATGGCACCAAGTGCACACATGGCGCGTGTTTGAACGGCGTCTGCCATTGCAATGACGGCTACGGCGGC
      TGCAATTGCGTGGACAAAGATGAGAACGAATGCAAACAGCGGCCGTGCGACGTGTTCGCCCATTGCACAAACACACTGGG
      CAGCTTCACGTGTACCTGCTTTCCGGGCTATCGAGGCAATGGTTTTCATTGTGAAGACATTGACGAATGCCAAGATCCCG
      CGATAGCAGCGCGATGCGTGGAGAACGCCGAGTGCTGCAACCTGCCGGCGCACTTCCTCTGCAAGTGCAAGGATGGATAC
      GAGGGCGACGGCGAAGTTCTGTGCACGGATGTGGACGAGTGTCGCAATCCGGAGAACTGCGGTCCCAACGCTCTGTGCAC
      CAACACGCCGGGCAATTACACATGCTCCTGCCCGGACGGCTATGTGGGCAACAATCCGTATCGGGAGGGATGCCAGGATG
      TGGACGAGTGCTCGTACCCGAATGTCTGCGGACCCGGTGCCATATGTACGAATCTCGAGGGCAGTTATCGCTGCGACTGC
      CCGCCGGGATACGACGGCGATGGACGCTCGGAGTCCGGTTGCGTGGATCAGGATGAGTGCGCACGGACGCCCTGCGGCCG
      GAACGCGGATTGTTTGAACACGGACGGCAGCTTCCGCTGCTTGTGTCCGGACGGCTACAGTGGTGATCCCATGAACGGCT
      GCGAGGATGTCGATGAATGCGCCACTAACAATCCATGCGGTTTGGGTGCTGAATGCGTGAACCTGGGCGGTAGCTTCCAG
      TGCCGCTGTCCCTCCGGCTTTGTGTTGGAGCACGATCCGCACGCGGATCAGTTGCCCCAGCCGCTGAACACCCAACAATT
      GGGCTACGGGCCGGGGGCGACGGACATTGCGCCCTATCAAAGGACCTCCGGCGCCGGTCTGGCATGCCTGGACATCGATG
      AGTGCAATCAGCCGGATGGAGTGGCCAAGTGCGGCACCAATGCCAAGTGCATTAACTTTCCCGGCTCATACCGCTGCCTG
      TGTCCGAGTGGATTCCAAGGACAGGGCTATTTGCACTGCGAGAACATCAACGAGTGTCAGGATAATCCGTGTGGGGAGAA
      TGCGATCTGTACGGACACCGTTGGCAGCTTCGTGTGCACATGCAAACCGGACTATACCGGTGATCCGTTCCGCGGATGTG
      TGGATATCGATGAGTGTACCGCGTTGGATAAGCCCTGTGGACAGCATGCGGTATGCGAAAATACCGTTCCTGGCTACAAT
      TGCAAGTGCCCGCAGGGATATGATGGCAAACCCGATCCCAAGGTGGCCTGCGAACAGGTGGATGTCAATATACTGTGCAG
      CAGTAACTTCGATTGTACCAACAATGCGGAGTGCATTGAGAATCAGTGCTTCTGCTTGGATGGATTCGAACCGATTGGAT
      CCAGTTGTGTGGACATCGATGAGTGTCGCACCCATGCCGAGGTGTGTGGTCCCCATGCCCAGTGCCTGAATACGCCCGGA
      TCGTACGGCTGTGAATGCGAGGCGGGATATGTGGGTAGTCCGCCAAGAATGGCGTGCAAGCAGCCATGCGAGGATGTTCG
      CTGTGGAGCCCACGCCTACTGCAAACCGGACCAGAATGAAGCCTACTGTGTGTGCGAGGATGGATGGACCTACAACCCGA
      GCGATGTCGCTGCGGGCTGTGTGGACATCGATGAGTGCGATGTGATGCATGGACCTTTCGGAAGCTGTGGCCAAAATGCC
      ACGTGTACAAACAGTGCCGGAGGATTTACATGTGCCTGCCCACCTGGATTCTCGGGAGATCCGCACTCTAAATGCGTCGA
      TGTGGATGAGTGCCGAACCGGAGCCAGCAAGTGTGGAGCTGGAGCTGAATGTGTGAACGTACCCGGTGGTGGATACACCT
      GTCGTTGCCCCGGGAACACCATTGCCGATCCGGATCCTAGTGTGAGGTGTGTGCCCATTGTCAGCTGCTCCGCTAACGAA
      GACTGCCCGGGTAACTCCATATGTGATGCTACAAAGCGCTGCCTGTGTCCGGAACCGAATATTGGTAATGACTGCCGTCA
      TCCGTGCGAAGCCCTCAACTGTGGAGCACATGCCCAGTGCATGCTGGCCAATGGACAGGCTCAGTGCCTGTGTGCTCCCG
      GATACACAGGAAACTCTGCCCTTGCAGGAGGCTGTAATGACATCGATGAATGTCGCGCCAATCCCTGCGCCGAGAAGGCA
      ATCTGTTCGAATACAGCCGGAGGGTATCTATGTCAGTGTCCAGGAGGATCCAGTGGAGATCCATACCGCGAGGGGTGTAT
      TACCTCAAAGACGGTGGGCTGCTCTGATGCCAATCCTTGCGCGACTGGCGAGACTTGCGTCCAAGACTCATACACGGGCA
      ATAGCGTATGCATTTGTCGACAGGGCTATGAGCGAAATTCCGAGAACGGACAGTGCCAGGATGTGGATGAATGCTCGGTG
      CAAAGAGGAAAGCCCGCTTGTGGACTAAATGCTCTCTGTAAGAATTTGCCTGGCAGCTACGAGTGCCGCTGCCCACAGGG
      TCATAACGGAAATCCCTTCATCATGTGCGAGATCTGCAATACGCCTGAGTGCCAGTGTCAGTCACCGTACAAGCTTGTTG
      GAAATAGTTGTGTTCTCTCCGGTTGCTCCAGTGGACAGGCCTGTCCCAGCGGAGCTGAGTGCATCTCCATTGCTGGAGGT
      GTTAGCTACTGTGCCTGTCCCAAGGGTTACCAAACCCAACCGGATGGAAGCTGTGTGGATGTCGACGAGTGCGAAGAACG
      GGGCGCGCAATTGTGTGCTTTTGGCGCTCAGTGCGTGAACAAGCCTGGAAGCTATAGTTGCCACTGTCCCGAGGGTTACC
      AGGGAGATGCCTACAACGGATTATGTGCACTCGCACAAAGGAAATGCGCTGCCGATAGGGAGTGCGCTGCCAACGAAAAA
      TGCATCCAGCCAGGAGAGTGTGTTTGCCCGCCTCCTTATTTCTTGGACCCGCAGGACAACAACAAGTGCAAGAGCCCTTG
      CGAACGCTTCCCATGTGGCATTAACGCTAAGTGTACGCCCTCGGATCCTCCACAGTGCATGTGCGAGGCTGGATTCAAGG
      GAGATCCACTGCTGGGATGTACAGATGAAGACGAGTGCTCCCATCTCCCATGTGCCTATGGAGCCTACTGTGTAAACAAA
      AAGGGCGGATACCAGTGCGTGTGCCCCAAGGATTATACCGGAGATCCGTACAAGAGTGGATGCATCTTCGAGAGCGGCAC
      GCCGAAGAGCAAGTGTCTGAGCAACGATGATTGCGCAAGTAATCTAGCCTGCTTGGAAGGTAGCTGCGTAAGTCCATGCA
      GCAGTCTTCTGTGTGGATCGAATGCCTACTGTGAGACAGAGCAACATGCTGGCTGGTGTCGCTGTCGTGTGGGATACGTT
      AAAAATGGCGATGGGGACTGCGTGTCTCAGTGCCAGGACGTGATCTGCGGCGATGGTGCTCTATGCATTCCAACCAGTGA
      GGGACCCACCTGTAAGTGCCCGCAAGGACAGCTCGGCAATCCCTTCCCCGGCGGCAGCTGCAGCACGGATCAGTGTTCAG
      CCGCCAGGCCTTGTGGCGAGCGGCAGATTTGCATCAATGGAAGATGCAAGGAGCGCTGCGAGGGTGTGGTCTGTGGCATC
      GGAGCCACCTGCGATAGAAACAATGGAAAGTGCATCTGCGAGCCGAACTTTGTGGGTAATCCCGACTTGATCTGTATGCC
      ACCCATCGAGCAGGCCAAGTGCTCTCCAGGATGTGGAGAGAACGCTCACTGCGAGTACGGATTGGGTCAGAGCCGATGCG
      CCTGTAACCCGGGAACCTTCGGTAATCCCTATGAAGGCTGTGGAGCACAAAGCAAGAACGTCTGTCAGCCGAATAGCTGT
      GGACCCAATGCCGAATGCCGTGCTGTGGGCAACCACATATCCTGTCTTTGCCCACAGGGCTTCAGTGGTAATCCCTACAT
      TGGCTGCCAGGATGTGGATGAGTGTGCCAACAAACCATGTGGTCTGAATGCTGCCTGTTTGAATAGAGCCGGAGGATTCG
      AGTGCTTGTGTCTTTCGGGACACGCCGGAAATCCCTACAGTAGTTGTCAACCCATCGAGAGCAAGTTCTGCCAAGATGCG
      AACAAGTGCCAGTGCAACGAACGAGTGGAGTGTCCGGAAGGCTACAGTTGCCAAAAGGGACAGTGCAAGAACCTCTGTTC
      CCAGGCTTCGTGTGGCCCAAGGGCCATCTGCGATGCCGGTAATTGCATCTGCCCCATGGGCTACATTGGAGATCCCCACG
      ACCAAGTGCACGGTTGCAGCATTCGCGGTCAGTGTGGCAATGATGCGGACTGCCTGCACTCTGAGATCTGTTTCCAGTTA
      GGCAAGGGTCTGCGCAAATGTGTGGACGCATGCTCCAAGATTCAGTGTGGACCCAATGCCCTCTGCGTGTCCGAGGATCA
      TCGATCTTCCTGTATATGCTCTGACGGATTCTTCGGAAATCCAAGCAACCTACAGGTGGGATGCCAGCCGGAAAGAACAG
      TTCCCGAGGAAGAGGATAAATGTAAATCGGATCAGGACTGTAGTCGAGGATACGGTTGTCAGGCCAGCGTTAACGGCATC
      AAGGAGTGCATTAATCTCTGCTCCAATGTTGTCTGCGGACCCAACGAGCTGTGCAAGATCAACCCAGCTGGGCATGCGAT
      TTGTAATTGCGCCGAGAGCTATGTCTGGAACCCAGTGGTCTCTTCCTGCGAAAAGCCTTCACTGCCAGACTGCACCAGTG
      ACGCTAATTGCCCGGATGCTTCTGCCTGTCGTCCTGATGTCTTGGGAGTCCTTAAGTGCGTCGCCATCTGTGATGCCTTC
      ACGTGCCCGGCCAACTCGGTTTGCGTAGCCCGTCAGCACCAGGGACGATGTGATTGTCTCAACGGGTTTGTGGGTAACCC
      CAACGATAGGAACGGCTGTCAGCCGGCACAGAAACATCACTGCAGAAACCATGCAGAGTGCCAGGAGTCGGAAGCCTGTA
      TTAAGGATGAATCTACCCAGACTCTCGGATGTCGTCCAGCTTGTGATACGGTGAAATGTGGACCCCGAGCCGTTTGCGTC
      ACCAACAATCATCAGGCGCAGTGTCAGTGTCCACCTGGACCTTTCGCCGGAGATCCATACGATCCATTTAATGGCTGCCA
      GAGTGTTCCTTGTGTTTACAACCATGACTGCCCACCCAGCCAGATGTGCAACCGTATGACACACACATGCTTCGATGTGT
      GCGACGAGGAGTCCTGCGGTGACAATGCCATCTGTTTGGCTGAGGATCATCGAGCCGTCTGCCAGTGTCCACCTGGATTT
      AAGGGAGATCCGTTACCCGAAGTGGCCTGCACCAAGCAAGGCGGTTGTGCCGCTGGAACTTGCCACCCCTCAGCAATATG
      CGAGGTCACTCCGGAAGGTCCTGTCTGCAAGTGTCCTCCGCTATTTGTGGGCGACGCGAAGTCAGGTGGCTGTCGGCCAG
      ATGGTCAGTGCCCGAATGGAGACGCCGATTGCCCAGCCAATACCATCTGCGCCGGAGGAGTATGCCAAAATCCCTGCGAC
      AACGCTTGCGGATCGAATGCTGAGTGCAAGGTTATCAATAGGAAACCCGTCTGCAGTTGTCCCCTGCGATTCCAGCCTAT
      CTCTGACACTGCCAAGGATGGATGTGCCCGGACCATATCTAAATGTCTCACTGATGTCGACTGCGGAGGAGCGCTGTGCT
      ACAATGGACAATGTCGTATTGCTTGCAGGAACAGCCAAGATTGCTCTGATGGCGAGAGCTGCTTGAAGAACGTCTGTGTG
      GTTGCCTGTCTGGATCACAGTCAGTGCGCTAGTGGACTGGCCTGTGTCGAGGGCCACTGCACCATCGGATGTCGCAGCAA
      CAAGGAGTGCAAGCAGGATCAGTCTTGCATTGAGAACAAGTGCCTGAATCCCTGCCAGTCTGCCAACAGTTGTGGTCCAA
      ATGCCCTGTGCAGCATTGATCAGCACCATAGCCAGTGCAGCTGCCCGGAAGGTTTCGAGGGCAACCCCACTCCAGAACAG
      GGATGCGTGCGAGTTCCGGCTCCCTGCTTAGCCAGTAATCAATGTCCCAGCGGACACATGTGCATTGGAAATCAGTGTAA
      TCTTCCCTGCACCAAAACAGCTTCCTGTGCAGTTGGAGAACGGTGCTATCAACAAGTCTGCCGCAAGGTGTGCTATACCA
      GCAACAACTGTTTGGCCGGAGAGATCTGTAATTCGGACAGGACGTGCCAACCAGGATGTGATTCAGATGCCGATTGTCCA
      CCCACCGAATTGTGTTTGACAGGAAAGTGCAAGTGCGCCACCGGATTTATAGGAACACCTTTCGGTTGCTCGGATATTGA
      TGAATGCACGGAACAACCCTGCCATGCCAGTGCTCGATGTGAGAACCTCCCGGGAACCTATCGTTGTGTATGCCCCGAAG
      GTACTGTCGGCGATGGGTACTCCCAGCCGGGTTGTTCGCAGCCCAGGCAATGCCACAAACCAGACGACTGTGCCAATAAT
      CTGGCCTGTATACATGGAAAGTGCACGGATCCCTGCCTACATACTGTTTGTGGTATTAATGCCAATTGCCAGTCGGAAGG
      ACACGAAGCTCTGTGCAGCTGTCCAGCTGGATTCTTGGGAGACCCCAACGACACTGGAGTCGGATGCTTTAAGGTGGAGT
      GCATCGACCATGTGGATTGCGCCGGAGATCGTGCCTGCGATGCGGAAACCAATCGATGTATTAAACCATGTGACCTGACC
      AGTTGTGGAAAGGGCAATTGCCAGGTGAGGGATCATAAGGCGACATGTGCCTGCTACGAAGGATATCAATTAGTGAACGA
      TGTATGTGAGGACATTAACGAGTGTCTGTCGCAGCCATGCCACAGCACAGCTTTTTGCAACAACCTTCCGGGAAGCTACA
      GTTGCCAGTGCCCGGAGGGATTGATCGGAGATCCCCTGCAGGCCGGTTGTCGGGATCCCAATGAGTGTTTGAGTGATGCG
      GATTGTCCTGCCTCAGCTAGTTGCCAGAATTCCCGATGCCGTAGCCCTTGCGAGCGACAAAATGCTTGTGGATTAAATGC
      TAACTGCCAGGCACAGGCCCATCAAGCCATTTGCACTTGCCCTCTCAATTCCCGTGGAGATCCAACCATCGAGTGCGTGC
      ACATTGAGTGCGCCGACAACGACGATTGCTCCGGGGAGAAAGCATGTTTGGACTCGAAGTGCATAGATCCATGTTCTCTG
      CCCAACGCCTGTGGAGCTTTGGCTCGCTGCTCGGTGCAGAACCACATCGGCGTCTGCTCCTGCGAAGCGGGCAGTACCGG
      AGATGCCAAATTGGGCTGTGTGCAACTGCAATATTGCCAGCAGGACGGACAATGTGCCCAGGGAAGCATATGCTCCCATG
      GAATTTGCAGTCCGCTGTGCAGCACCAACCGCGATTGTATTTCGGAACAGTTGTGCTTGCAGGGCGTCTGTCAGGGAACC
      TGCAAGTCAAACTCAAGCTGTCCCCAATTCCAATTCTGTTCGAATAACATTTGCACCAAGGAGCTGGAGTGCCGATCCGA
      TAGCGAATGTGGCGAAGACGAAACCTGTCTGAGTGATGCCTATGGGCGTGCAAAGTGTGAATCCGTTTGTCTTGGTCGCG
      CTGCCTGTGGTAGGAATGCAGAATGTGTAGCCCGTTCCCATGCTCCCGATTGCCTCTGCAAGGAGGGATTCTTCGGGGAC
      GCCAAGTCTGGATGCCGAAAGATCGAGTGCACCAGCGACGATGACTGCTCCAATGACAAGAGCTGTGACAACCACATGTG
      CAAGATTGCCTGCCTAATTGGACAGCCGTGCGGAGAGAATGCCCTCTGCACCACAGAACACCACCAGCAGGTTTGCCACT
      GCCAGCCAGGATTCTCTGGAGATCCGCGGGTTCGTTGCGATGTTATAGACTTTTGCCGGGATGCTCCGTGCGGACCCGGA
      GCCCGTTGCCGAAACGCGAGGGGGTCGTACAAGTGCACCTGTCCACCGGGACTCGTTGGTGATCCGTACAACGAGGGCTG
      TCGCAGCTCCGTTGAGTGCGAGACCAACGAGGACTGTCCCCCGCATGCCGCATGCACCAAAACCAATGGGGTGGCCAAGT
      GCCGCGATGTCTGTGCCCAGCTGCAATGTGGCCCCAATGCGGAATGTGTTCCGAAGGGCCACGTGGCGCAGTGTGCATGC
      CGCAGCGGCTACGATGGCCAACCCGCCGACCGGGTGGCCGGCTGTAAGCCGCTGCCCTCTCCCTGTCAGGTCACCGGCGA
      CTGTCCGACCAACACATACTGCTCGGATAGCGTCTGCAAACCTGCCTGTGTTCTGGACACCGAATGTGGAGCATTTGAAG
      TGTGTCAAGGTGGCCAATGCTTCAATCCGTGCCTTCAACCTCAAGCTTGTGGCCAGAATGCCGAGTGCGTGATGCAGAAT
      CATCTGAAACAGTGCCATTGCCCGGAGGGCTTCACCGGCGACTCAGCGAAGGAGTGCGTGCGTGTGCCAGTGGCCTGTGA
      TGGCGAGTGTGGTCCAGGATATACCTGCCGCGACTCCATGTGCCTGCCTGTTTGCCACAACGATCTGGAGTGCGCCTCCA
      ACGAAAAGTGCCTGAAGGGCAGCTGTATGCTGACCTGTCGGGTGGACAACGATTGCTTCCTGGGTCACGTTTGCCTGCAC
      AACAAGTGCGTGTATGGCTGCCATGTGGACGATGACTGCAGTGCGTCAGAGTCTTGTCGCAACGATAAGTGCGTAAACCC
      CTGTCTGGAAAATCCCTGTGGTCCCAATGCCGCCTGTTCGGTGTCCAACCACCGGGCTAGCTGCAGTTGTTTGGAGAGTA
      TGGTGCCCAATCCCACACCCCAGGTGGGCTGCGTCCGTTCTCCCCCCTTGGAATGCCGCGAGAATCGCGACTGTGGAAAT
      GGATTGGCTTGCTTCGAGTCGGTATGTCGACCACTATGCGCCGACGATGCTGGCTGCTTGACCAACGAGCGATGCCAGCA
      GGGAGTTTGCAAACCCCTGTGCCGCCACGACAATGAGTGCGGTCATGGAGAGCTCTGTCTGGGCCTGAACTGCGTACCTG
      GATGCCGGTCCGATCAGGGCTGCCCGCCGGAATTGTCCTGCGTGGGTCAGCAGTGCGTGGATCCATGTGCAGATCCCACT
      GCCTGCGGCACCAATGCCCACTGTCAAACGATCGATCACAGGAAACAGTGCCTATGTCCAGAGGGTCTTGATGGCAATGC
      CAATGTGGCCTGCAAGGTGCCTCGCATTGCTTGTGGCAGGAACGAGGATTGCCAGTCGAATCAGCTATGCTATGCCGGCA
      GCTGCCAAGGAAAGTGCAGAAACGACCAGAACTGCTTGGCCGATGAGCGTTGCATGAGAGGAACATGTAGAACCGTATGC
      AACACCGATGAGGCATGTGCTCAGGGACAGATTTGCGAGAATCGAATGTGCCAGACTGGATGTCGTACCGATTTGAGTTG
      TGCCACCGACGAGGCCTGCGTGAACAAGAAGTGCCAGAATCCATGTCGTACACCCGGCCAATGTGGCCAGTGTGCCGACT
      GCCTTGTGGTCAACCATGGAGTCCAGTGCCAGTGTCCCGCCGCCTTTATGGGAGACGGTTTGACAGGCTGTCAACTTCCG
      CCGGAACGCTGTCATCCTGACTGTGAATGCGACGAAAATGGAGCCTACTGTGCCCCCAAGTGCTCGAGAACCGAGGATTG
      CGCCTGTGGACAACAGTGCGCCAGAGGAAAGTGCCGGAATAAGTGCGGACCCAAGCGCCAGTGTACGGTGGGTCAGCTTT
      GCGAGAGAGGCGCATGCATTGCCGGGTGCAAGTCCAACGGTGATTGTGCCGCCGACCAGAGTTGTGTCAATGGAAAGTGC
      TCCGATCCGTGTGCGAACGAGAAGGCTTGCGGACGGAATGCTCTTTGCACTGTGTCCGAGCACCGGATGCTCTGCTACTG
      CCCGGATGGATATGAAGGCGAGCCCAGCAAGGAGTGCGTGCAGTTCGAGTGCCGTGTGGACACCGATTGCGACAGCAATA
      AGCGCTGCGATCAAGGAAAGTGCCGCAATCCTTGCCTGGAGTATGGAGCTTGTGGAACGAATGCTCAGTGTCGAGTTGTC
      GGTCGCAAGGCCCAATGTTCATGTCCGCCGGACTTCTTTGGCAATCCGACTAGTGAGTGCCGACCGCTGGAAGGTGGATG
      CTCTAGCAAACCCTGCGGTGAGAACTCCAAGTGTACTGAAGTGCCCGGAGGCTATGAATGCGCTTGCATGGACGGCTGCA
      TTGGAGATGCCCACCAGGGATGCCTTTGCGGCGGACCTCTAGTGAATGCCTGTCGCGATCAACCGTGCGGTCTGAATGCC
      GCCTGCCACGTATTGGAAAACAATCAAGCCGAGTGCTACTGCCCGGAGGACTTCCCCAATGGTGATGCTTATGTACAATG
      TTACTTGACTACGCCGAAGCAGGATTGTCGTACCCTTGGATGCGAAGTCGGCGGCTGTGTACGCCAGGGCTATGAATACG
      TTTGCCAGCAGGACACCGAACAATGCTACTCAGATACGGATTGTCCCAGTGAAAAGTCATGCCTCCAAGGACACTGCAGC
      GATCCTTGTACAATGCGTGGCGTGTGTGGTTTGAATGCTCTCTGCAAAACCGTACTGCATCGACCGCGCTGCTCCTGCCC
      CAGTTGCCACATCGGTCGGCCAGAGATCGAGTGTAAGTCTGATCCCAAGTGCGTGGCCGAGGACACGGATCCAAAGACCA
      AGGAGCAGATCCCATGCTCCACAGACTCCGAGTGTCCAGAGACATTGCAGTGCGGCCAGTACGGCCAATGCACAGATCCG
      TGCAACAATCCGCTCTTCATCTGCGAGAGCAACAAGAAGTGCGAGACGCGACGCCACCAGCCCGTTTGTATCTGCAAATC
      GGGCTTCATAGTGAATGAGTACGGAGAACTGACGTGCGCCCCGGACAAGCGGGAGTGCTATCGCGACGATGACTGCGCCT
      CGAACATGGCCTGCTCCGATGGCAAGTGCCGCAATCCCTGCATCGTGCCCCTGGGCCGAGCCGCAATCTGTGCCGAGAAC
      AAGTCCTGCGAGGTGCAGAACCACAAGCCAGTCTGCATTTGCATGCGCGACTGCCAGCCATCCATATCGATTTGCCTGCG
      CGACGCCGGCTGTCCGGCTAGCCAGGCTTGCCGGAAGCTCAAGTGCGTCGATCCGTGCGAGTTTGCCACATGCGCACCCA
      ACTCGCCATGCATTGTCGAGGATCACAAGCCGATATGTAAATTCTGCCCAGCTGGATTTATAGCCGATGCCAAGAATGGA
      TGTCAAAAAGCTAAGCCAGGTGGAAACTGTACGTCAAACACAGATTGCAGTCAAGCGCACCAATGTGGATCGTCGGGAAA
      ATGTATCGACCCCTGCCTCACTTCCTGTGCAGGCGGAGTAAAGTGTGTTGTATCAGCACATAGGGTTACTATATGTACTT
      GTCCAGCCACCTTAACAAACAACACAGATTCGAACTGCACCTCGACAGACATAACAGTCGGGACTACAACGCAAAGAATT
      GAAACTACAACAGACTTCATTAACGTAAAATACACTGTAATGCAATTGGCAAATCAAACTGAAATGAGAACCCGCTTTAC
      CGATATAGAAGCCGAAAACGAAACAACAGGTCCTTACACAACCACAACAGAGTCCTATAAGACGACTAAGCAACTTTCTT
      CTAACCCAGAAACAGAGACACCCACAACTTTACCTTCACGCCCAACAACTAGACCATTTACTGATCAAACGACTGAATTT
      ACTAGTGAAATTCCCACTATCACACCAATGGAGGGATCTACTCCCACACCATCACATCTAGAAACCACTGTCGCATCAAT
      CACCTCAGAATCCACTACCAGAGAAGTATATACCATCAAGCCCTTCGATAGATCTACTCCCACTCCAGTATCGCCGGACA
      CTACTGTTCCATCAATCACTTTTGAAACCACCACAAATATTCCGATTGGAACAACACGAGGGCAAGTGACAGAACAGACT
      ACATCTTCTCCCAGCGAAAAGAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCTAGGTCAACGGATAGAACCAC
      TCCATCCGAAAGTCCTGAGACACCCACAATATTACCTTCAGACTCCACTACTCGAACTTACTCAGATCAAACGACTGAAT
      CTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCA
      GTTACTTTAGAAACCACTACAAATGATCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAG
      CGAAGTCAGAACTACAATAGGTCTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTC
      CTGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGATCAAACGACTGAATCTACTAGAGACGTT
      CCAACCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAAC
      CACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTGAGAACTA
      CAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCAACA
      ACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAACAAACAACTGAATCTACTAGAGACGTTCCAACCACCCGCCC
      ATTTGAGGCATCCACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTC
      CAATCGGTTCAACAGGTGGGCAAGTGACAGGACAAACTACATCTTCTCCGAGCGAAGTGAGAACTACAATACGCGTTGAA
      GAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGA
      CTTCATAACTAGACCTCACTCAGAAAAAACAACTGAATCTACCAGAGACGTTCCAACCACCCGCCCATTTGAGGCATCTA
      CTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACA
      GGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCC
      TTCAAGGTCAGCGGATAGAACTACTCTATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAATTAGAC
      CTCACTCAGAACAAACGACTGAATCAACTAGAGACGTTCCAACCACCAGGCCATTTGAGGCATCTACTCCCAGTCCAGCA
      TCTCTGGAAACTACTGTTCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGAC
      AGGACAGACTACTGCACCGCCGAGCGAATTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCTAGGTCAACGG
      ATAGAACCACTCCATCCGAAAGTCCTGAGACACCCACAATATTACCTTCAGACTCCACTACTCGAACTTACTCAGATCAA
      ACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAAC
      TGTTCCATCGGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACAT
      CTTCTCCGAGCGAAGTGAGAACTACAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCA
      TCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGAAAAAACAACTGAATCTAC
      CAGAGACGTTCCAACCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTA
      CTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAA
      GTGAGAACTACAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGA
      GACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGAAAAAACAACTGAATCTACCAGAGACGTTCCAA
      CCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACT
      ACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTCAGAACTACAAT
      ACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAAACACCAACAACAT
      TACCTTCAGACTTCACAACTAGACCTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTT
      GAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTCCAAT
      CGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAAT
      CTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTC
      ATAACTCGAACTTACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCC
      CAGTCCAGCATCTCTGGAAACTACTGTTCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTG
      GGCAAGTGACAGGACAGACTACTGCACCGCCGAGCGAATTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCA
      AGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAACTAGACCTCA
      CTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCAGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTC
      TGGAAACTACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAA
      CAAACTACATCTTCTCCGAGCGAAGTGAGAACTACAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAG
      AACTACTCCATCCGAAAGTCCTGAGACACCAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAACAAACGACTG
      AATCTACTAGAGACGTTCCGGCCACCAGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACTACTGTTCCA
      TCAGTCACTTCAGAAGCCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCC
      GAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCTCCATCCGAAA
      GTCCTGAAACACCAACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAACGACTGAATGTACTAGAGAC
      GTTCCAACCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGA
      AACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTGAGAA
      CTACAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCA
      ACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCACCAGGCC
      ATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTC
      CAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAATTCAGAACTACAATACGCGTTGAA
      GAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCAACATTACCTTCAGACTT
      CACAACTAGACCTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCACCAGGCCATTTGAGGCATCTACTC
      CCAGTCCAGCATCTCTGGAAACTACTGTTCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGT
      GGGCAAGTGACAGGACAGACTACTGCACCGCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTC
      TAGGTCAACGGATAGAACCACTCCATCCGAAAGTCCTGAGACACCCACAATATTACCTTCAGACTCCACTACTCGAACTT
      ACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCT
      CTGGAAACAACTGTTCCATCGGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGG
      ACAGACTACTGCAACGCCGAGCGAAGTCAGAACTACAATAGGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATA
      GAACTTCTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAACG
      ACTGAATCAACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACTACTGT
      TCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTT
      CTCCGAGCGAAGTCAGAACTACAATAGGTCTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCTCCATCC
      GAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGATCAAACGACTGAATCTACTAG
      AGACGTTCCAACCACCAGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACTACTGTTCCATCAGTCACTT
      CAGAAACTACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGACAGGACAGACTACTGCACCGCCGAGCGAAGTC
      AGAACTACAATAGGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCTCCATCCGAAAGTCCTGAGAC
      ACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCA
      CCCGTCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGAAAACAACTGTTCCATCAGTCACTTCAGAAGCCACTACA
      AATGTTCCAATCGGTTCAACAGGTCAACGGATAGGAACTACTCCATCCGAAAGTCCTGAAACACCAACAACATTACCTTC
      AGACTTCACAACTAGACCTCACTCAGAAAAAACAACTGAATCTACTAGAGACGTTCCAACCACCCGACCATTCGAGACAT
      CTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCA
      ACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTGAGAACTACAATACGCGTTGAAGAATCTACACT
      TCCTTCAAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCAACATTACCTTCAGACTTCACAACTAGAC
      CTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCACCAGGCCATTTGAGGCATCTACTCCCAGTCCAGCA
      TCTCTGGAAACTACTGTTCCATCAGTCACTTCAGAAACTACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGAC
      AGGACAGACTACTGCACCGCCGAGCGAAGTCAGAACTACAATAGGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGG
      ATAGAACTTCTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGAACAA
      ACGACTGAATCTACTAGAGACGTTCCAACCACCCGTCCATTTGAAGCATCTACTCCCAGTCCAGCATCTCTGAAAACAAC
      TGTTCCATCAGTCACTTCAGAAGCCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACAT
      CTTCTCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCA
      TCCGAAAGTCCTGAAACACCAACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAAAAAACAACTGAATCTAC
      TAGAGACGTTCCAACCACCCGACCATTCGAGACATCTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTTA
      CTTTAGAAACCACTACAAGTGTTCCAATGGGTTCAACAGGTGGGCAAGTGACAGGACAGACTACTGCACCGCCGAGCGAA
      GTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCTCCATCCGAAAGTCCTGA
      GACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGAAAAAACAACTGAATCTACTAGAGACGTTCCAA
      CCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCAC
      TACAAATGTTCCAATCGGTTCAACAGGTCAGCGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCAACATTACCTTC
      AGACTTCACAACTAGACCTCACTCAGAACAAACGACTGAATCTACTAGAGACGTTCCAACCACCAGGCCATTTGAGGCAT
      CTACTCCCAGTCCAGCATCTCTGGAAACTACTGTTCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCA
      ACAGGTGGGCAAGTGACAGGACAGACTACTGCACCGCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACT
      TCCTTCTAGGTCAACGGATAGAACCACTCCATCCGAAAGTCCTGAGACACCCACAATATTACCTTCAGACTTCACAACTA
      GACCTCACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGACCA
      GTAACTCTAGAAACTGCTGTTCCATCGGTTACTTTAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGT
      GACAGGACAGACTACTGCAACGCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAA
      CGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAT
      CAAACGACTGAATCAACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAAC
      TACTGTTCCATCAGTCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGACAGAACAAACTA
      CATCTTCTCCGAGCGAAGTCAGAACTACAATAGGTCTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCT
      CCATCCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGATCAAACGACTGAATC
      AACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACTACTGTTCCATCAG
      TCACTTCAGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGC
      GAAGTCAGAACTACAATAGGTCTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTCTCCATCCGAAAGTCC
      TGAGACACCCACAACATTACCTTCAGACTTCATAACTAGACCTCACTCAGATCAAACGACTGAATCTACTAGAGACGTTC
      CAACCACCCGCCCATTTGAGGCATCTACTCCCAGTTCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACC
      ACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTGAGAACTAC
      AATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAAACACCAACAA
      CATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAACGACTGAATCTTCTAGAGACGTTCCAACCACCCAGCCA
      TTTGAGGCATCTACTCCCAGACCAGTAACTCTACAAACTGCTGTTCTACCAGTAACTTCAGAAACCACTACAAATGTTCC
      AATCGGTTCAACAGGTGGGCAAGTGACAGAACAAACTACATCTTCTCCGAGCGAAGTCAGAACTACAATACGTGTTGAAG
      AATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAAACACCAACAACATTACCTTCAGAC
      TTCACAACTAGACCTCACTCAGATCAAACGACTGAATCTTCTAGAGACGTTCCAACCACCCAGCCATTTGAGTCATCTAC
      TCCCAGACCAGTAACTCTAGAAACTGCTGTTCCACCAGTAACTTCAGAAACCACCACAAATGTTCCAATCGGTTCAACAG
      GTGGGCAAGTGACAGAACAGACTACACCTTCTCCGAGCGAAGTCAGAACTACAATACGTATTGAAGAATCTACATTTCCG
      TCAAGGTCAACGGATAGAACTACTCCATCTGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAACTAGACC
      TCACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGTCATCTACTCCCAGACCAGTAA
      CTCTAGAAATTGCTGTTCCCCCAGTAACTTCAGAAACCACTACAAATGTTGCAATCGGTTCAACAGGTGGGCAAGTGACA
      GAACAAACTACATCTTCTCCGAGCGAAGTCAGAACTACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGA
      TAGAACTACTCCATCCGAAAGTCCTGAAACACCAACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAA
      CGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAACT
      GTTCCATCAGTTACTTTAGAAACCACTACAAGTGTTCCAATGGGTTCAACAGGTGGGCAAGTGACAGGACAGACTACTGC
      ACCGCCGAGCGAAGTCAGAACTACAATACGCGTTGAAGAATCTACACTTCCTTCGAGGTCAACGGATAGAACTCCTCCAT
      CCGAAAGTCCTGAGACACCCACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAACGACTGAATCTTCT
      AGAGACGTTCCAACCACCCAGCCATTTGAGTCATCTACTCCCAGACCAGTAACTCTAGAAATTGCTGTTCCCCCAGTAAC
      TTCAGAAACCACTACAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGGACAGACTACTGCAACGCCGAGCGAAG
      TCAGAACTACAATAGGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAG
      ACACCCACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAAC
      CACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTTACTTTAGAAACCACTA
      CAAATGTTCCAATCGGTTCAACAGGTGGGCAAGTGACAGGACAGACTACTGCAACGCCGAGCGAAGTCAGAACTACAATA
      GGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTACTCCATCCGAAAGTCCTGAGACACCCACAACATT
      ACCTTCAGACTTCACTACTAGACCTCACTCAGATCAAACGACTGAATCTACTAGAGACGTTCCAACCACCCGGCCATTTG
      AGGCATCTACTCCCAGACCAGTAACTCTAGAAACTGCTGTTCCATCAGTAACTTCAGAAACCACCACAAATGTTCCAATT
      GGTTCAACAGTAACTTCAGAAACCACCACAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGGCAGGACAGACAACTGC
      ACCGCCGAGCGAAGTCAGAACTACAATACGCGTTGAAGAATCTACACTTCCTTCAAGGTCAGCGGATAGAACTACTCCAT
      CCGAAAGTCCTGAGACACCAACAACATTACCTTCAGACTTCACAACTAGACCTCACTCAGAACAAACGACTGAATCTACT
      AGAGACGTTCCAACCACCCGGCCATTTGAGGCATCTACTCCCAGTCCAGCATCTCTGGAAACAACTGTTCCATCAGTCAC
      TTCTGAAACCACTACAAATGTTCCAATTGGTTCAACAGGTGGGCAATTGACAGAACAGAGTACATCTTCTCCGAGCGAAG
      TGAGAACAACAATACGTGTTGAAGAATCTACACTTCCTTCAAGGTCAACGGATAGAACTTTTCCATCCGAAAGTCCTGAG
      AAACCCACAACATTACCTTCAGACTTCACTACTAGACCTCACTTAGAACAAACAACTGAATCTACTAGAGACGTTCTTAC
      CACCCGTCCATTTGAGACATCTACTCCCAGTCCAGTATCTCTGGAAACTACCGTTCCATCAGTCACTTCAGAAACCTCTA
      CAAATGTTCCAATTGGTTCAACAGGTGGGCAAGTGACAGAACAGACTACTGCACCTCCGAGCGTCAGAACAACTGAAACT
      ATAGTAAAATCTACTCATCCTGCAGTTTCACCCGATACAACTATTCCATCCGAAATTCCAGCCACGAGAGTACCTTTAGA
      GTCAACTACTCGGCTATATACTGACCAAACAATTCCACCTGGATCAACGGACAGAACAACTTCATCCGAAAGACCGGACG
      AAAGCACTAGATTAACCAGTGAAGAATCAACAGAAACTACTAGGCCAGTACCAACTGTGAGCCCAAGGGATGCATTAGAG
      ACGACAGTTACTTCATTAATCACAGAAACAACCAAAACTACTTCTGGTGGTACACCACGAGGACAAGTGACAGAACGGAC
      TACCAAATCGGTCAGCGAATTAACGACTGGGCGCTCAAGTGACGTAGTGACAGAGCGTACTATGCCAAGTAATATTTCGT
      CAACTACGACTGTTTTCAACAATTCGGAACCCGTTTCGGATAATTTGCCAACTACAATAAGCATTACAGTGACAGATAGC
      CCAACGACAGTACCTGTACCGACTTGTAAAACAGACTATGACTGCTTGGACGAACAGACCTGCATTGGCGGACAGTGCAT
      ATCGCCCTGTGAATACTTCACTAATCTCTGCACGGTGCAGAATCTGACCATTTGTCGTACATTGAACCACACCACAAAGT
      GCTACTGTGATACCGACGATGATGTAAATAGACCCGATTGCTCTATGAAAGCAGAGATTGGATGCGCATCGAGTGATGAG
      TGTCCGTCCCAGCAGGCGTGCATTAATGCTCTTTGTGTGGATCCTTGCACCTTTAACAATCCCTGCAGCCGTAATGAAGA
      TTGCCGAGTTTTTAACCACCAGCCATTGTGCTCAGCCGAGCATGGTCGCACGCCTGGATGCGAGCATTGTCCACCAGGCG
      CGAACTGCGATCCAACAACCGGTGCTTGTATAAAGGCTAATGTAACAATAACAACTATTACTACCAAGAACTCCACATCT
      ACCAAGATACCAACGAAACCAAGAACAACAGCTAACCCAAACACAGGCGTCAAAACGACGCCGACAACCACAAGGGTCAC
      CACAAGAAATACCACCACGACCACAACCACTACTACCACTTCCTCCACTAGCACTGAATCGAGCACAATCACAAGCGCTA
      CTAACCAGACCAGTAAGAACCAAAAACCAGACACTGAAAGCACCACCTCCCACACCGATGCCACGAGGCGGTATCGCGAT
      GGTGAGAACAATATCACCGATACTCCGACACCGAGGCCCACGATCCAGACGACCACGCTGCGGGGCGAAGGTGTCATGGG
      TGACAGTCAGAGGCGGTCCACTACGACGCCCAAAATGAAGACCACCCGGCTGGATACTTCCAACGAGGTACCAGATACCA
      CATCGCCGTGGCCAATAGAGCTGCCCACAACGGAGGGCACCACCACGGAAGTCTACAACACCATGTTTGCCCCGGTGGTC
      AACACCACTGACACCTCATTAATTAACCCATGTACAGTAGATACTAATTGTGCCCCTAACGAGCACTGCAAACTGGGCCA
      TTGCCGTAAAAAAGAACCGCCGGGTTCACCGAAAACACCCGAACCCTGCCAATCTAACAACGACTGTATTGAGAGCGAGG
      CCTGTTACATGGGTTTGTGCCAGGATCCTTGTGAGTTTGCCAAGATCTGTGCCGCGACTGCCAAGTGCACGGCCAAGAGT
      CATCGACCAGTGTGCACCTGTCCGCAGGGCCATGAGGGCAATCCGATGGTCAAATGTGTAACCACTCAAACCTCAATTGA
      ATGCACTGACGATTCGGACTGCGGTGTCACGGAAGCGTGCATCAACCAACTTTGCCAGCATCCTTGCGATGTTCACGATC
      CTTGTGCCACGAATGCTGTTTGCATCAACAGCAACCACGCAGCTGACTGCAGTTGCGCGGATGGCTTCCAGGGCAATGGA
      TTTGTTGGCTGTCAGCCAGCACGTTCCCATGTCTGCCAATACAACGAGGACTGTCCACCGACGAAGCTCTGCGATCGCCT
      AAACCGACGCTGCATCAATCCCTGCCAAGAGGACTCTTGCGGCGAGAATGCCGAGTGCATACCCGTGAACCATGGCACTG
      AATGTCGCTGCCTGCCCGGATTTCTGGGCAACGCCTACGTGCAGTGTCTCCCTAGTCAGGGATGCCGCTCCGATTCCGAA
      TGTGATTCGAGTCAGGCCTGCATCAACGGAAAGTGCTCATCGCCCTGCCAGTGTGGAGCCTATGCCCTCTGCGATGTGGT
      TAATCATCGTGGTGTTTGCAAATGCCCTCCCGGCTACAACGGAAATCCCAAGGTGGGCTGCAGTCCGCCTCAAGATCCAT
      GCGACCCCAATCCATGTGGCTTAAATGCCTTGTGCGAACTGGACAATGGCAACCCCATCTGCTACTGCCCGAAGGGTCTT
      ACCGGAAATCCGTTCAAAAATTGCATTCCTGAGGGAGATGAGTGCACACCGAATCCCTGTGGTCCCAACTCTGGATGTCG
      TCGCGTAGGTGGAAACCCGGTGTGCTTCTGTCTGCCGGAATATGAGGGTCAACCACCGTCGATTCCTTGTGAGCTACCTT
      CCAATCCCTGCGACCCATCGCCTTGCGGACCGAATACTCAGTGCTCTGTGCTCAGCAATGGGTTCTCCAAGTGCACTTGT
      CTGCCGAACTATGTGGAGAGTCCGAACACCATCCGTGGATGTGTTGAACCTATTAACCCGTGTGACCCGAACCCTTGTGG
      AACTGGTGCAATCTGCGATTCATCACGTCACCCCGTGTGTTACTGCCCGGACAACAAGATTGGCAATCCTTTCAGACTGT
      GCGACAAACCTGCAGTTACCATTGAACTTTGCCAGCCAGGACCATGTGGTCGAAATGCCGAGTGCTATGTGGCTGGAAAT
      CGCGAGGAGTGCTACTGCCGCTCGGGATATGTGGGAGATGCTTACCAGGGATGCCGTGAACCGAGTCGCACCGTTTGCGA
      CCCCAATCCTTGTGGACCCAATGCCAACTGCGTTGTGGCTGGCGACGGACAAACGGCATGCGTTTGTCCTGACGGTTTGT
      CAGGAGATCCCACGTCCGTAATTGGCTGTCATGGCTACGAATGTCAGGTGGATGCCGATTGTCCAAATAGCAAGGCCTGC
      ATGGGCTACCGCTGCTACGATCCCTGTCCAGGAGCATGTGGCCAAGGAGCTCACTGCCAAGTGGAGGAACATCACCCAGT
      TTGCTCTTGTAACTCCGGCTTGACTGGTAACCCTGGAATTCGCTGCTATGCTTTGGACCATCCCAAAAAGAATCCTTGCG
      TTCCTAGCCCTTGTGGCCGAAATAGCGAGTGCAAGTTGCTAAATAACCGCGCTGTTTGTTCGTGCATCCCAGGTTACTTG
      GGCGATCCTCAATCGGGATGCCAACCTGAGTGCGACATTAACTCCGATTGCGGTGATACCTTGTCGTGCATTAACCACAA
      GTGCGTGGATCCATGTGCCGGAGCGATCTGTGGAATTAATGCCATCTGTAATGTGCGCCAGCATACGCCAGTATGTCTTT
      GCCTGGACGGCTTCGTCGGCGACGCCTTTTTGCAGTGCGTTCCCATTGGAATACTGAAGAACGTTTCTCGGGATCCGTGT
      GCTCCGTCGCCCTGTGGACCTCATGACGTTTGTTCGGTGTACGGCGATGGAGTGGCCCTTTGTGATCCCTGCTTTGGGCC
      AAATGCCCAGCAGAATCCACGCTGCCGACCCGAGTGCGTCGGCAATTCGGATTGTCCGTTTGATCGCGCCTGTTTGGGTC
      AGCGTTGTCTGGATCCCTGTCCCGGATCCTGTGGCCGGAATGCTATCTGTAATGTCTACGAACATAATCCCGTATGCGCT
      TGTCCCACAGGACTATTTGGCAATCCGTACGAACAGTGCACAACTAAGTCGGTGGTCGAGACGCCACCTCAACCCAGCTG
      TGCTAAACTCCATTGCGGTGCCAATGCGGAGTGCAAGCGTCAGCACAGCGGTCTGGCCTGCGTCTGTCGTAAGGGTTACT
      TCGGAGACCCTCATATTGGTTGTCGGCCAGAATGTGTTCTTAACAGTGACTGTCCCGCTGAAAAGGCTTGCTTGAACTCC
      AAGTGCGTGGAAGCGTGTACCGGTGTGTGTGGCGTTAATGCAGTTTGCCGTGTGGTTAACCATGCGCCTGTTTGCATATG
      CGCCGAGGGATATAGTGGAGATGCCTCTATTGCCTGCAATCCGTTCTACCTGCCACCTCCAGAGCGACCTCATCCGTGTG
      AGCCATCACCATGCGGACCAAACTCCCGATGCAAGGCCACCCCTGATGGCTATGCAGCCTGTTCCTGCCTGCCGAACTTC
      AAAGGAGCTCCACCAGTCTGTCAGCCAGAGTGTGTGGTTAGCTCGGAGTGTGCTCCCAACCAGGCATGTCTGAATCAGAG
      GTGCACAGATCCATGCCCAGGTATTTGCGGTGGTGGAGCTCGCTGCGAAGTGCTGAACCATAACCCCATCTGCTCCTGTG
      AGGCCAACTTCGAGGGTGATCCGTTTGTGGCGTGCTCACCCATTCAGGATCCAGGTCGCGACATCCCTGTGCCAAAGAAC
      CCGTGCGTGCCATCTCCTTGCGGACCCAACTCCATTTGCCAGATTAAACAAAACCGACCAGTCTGCTCCTGTGTGGCCAA
      CTATATCGGCAGCCCACCGTATTGCCGACCGGAGTGCACGCTGAGCAGTGAGTGCCCATCGGACAAGGCCTGCATCAACG
      AAAAGTGCCAGAATCCGTGTGCCAACGTATGTGGACACAATGCCCGTTGTACGGTCATCGCTCACTCCGCTCACTGCAGT
      TGTGACGAGGACTACGAGGGAGATGCCTTCATTGGTTGCTCTAAGAAGATTACAGAAAGGCCCGGTGATCACATTGATCC
      ATGCTACCCTAACCCATGTGCCGAGAACGCTGTTTGCACGCCATACAATAATGCCGCACGCTGTACCTGCATTGAGCCCT
      ATAATGGCGATCCTTACAGTACCGGATGTCGACCGGAATGTATCTACAGCTCGGAGTGCCCCTCATCGCTGGCCTGCATC
      AAGCAGCACTGTCGCGATCCATGCACGGCTGCTTGTGGAGCGAATGCCGAATGTACGGTGGTCAACCACTTACCCTCTTG
      CAGTTGCACCAGAGGATTTGAGGGTAATCCGTTTGACGGATGCAAACGGGTGGTCGTTGTGCGACCCGAAACCGTGTGTG
      AACCCAATCCCTGTGGACCGAACAGCATTTGTCGCTCTGTAGAGGGACATCCAACGTGCAGTTGCCAGGTCGGTTACTTC
      GGAGCTCCGCCACAGTGCAGACCCGAATGTGTGGTCAGCTCGGAGTGTGCTCAGCATTTGTCCTGCATAAATCAGAAGTG
      TATGGATCCGTGTGTGGGCACTTGTGGATTCAACGCCAAATGTCAAGTCAACAACCACAATCCTATTTGCTCCTGTCCAG
      CCAACTATGAGGGAAATCCATTTGAGCAATGCATGCCCAAACCCGCAGAACCAACTCGCAACGTAGATCCATGCCTTCCC
      AGCCCATGCGGTTCCAATTCCATTTGCCGAAATGTGAACAATAGGGCAGAGTGCTCTTGTGCGCCAGGAATGTTTGGAGC
      ACCACCGAACTGTCGACCTGAATGTGTGATTAACCAGGATTGCCCATCAAATCGAGCTTGTATACGGCAGCGGTGTGAGG
      ATCCTTGCATTGGCATTTGTGGCTTCAATGCCGTGTGCTCCACGCAGAACCACCAGCCCAAGTGCAGTTGCATTGAAAGC
      TTTGAGGGTGATCCGTACACCGCCTGCAAAATGCGTGAGATCGTGGTGCTAGATCCACCCACCGATCCATGCTATCCATC
      GCCATGTGGTGCGAATGCCATTTGTCGCGTGCGCAACGGAGCCGGCTCCTGTTCCTGCATCCAAAATTATTTCGGTGATC
      CCTATATCAACTGCCGCCCTGAGTGCGTCCAGAATAGCGATTGTCCCAATAACCGTGCCTGTATAAACATGAAGTGCCGC
      GATCCCTGCGCCAATGCCTGTGGATTTAATGCCATTTGCCGGGTGGCTCATCATCAGCCCGTCTGTAGTTGTGAACCCCA
      CTTAACAGGCAATCCACTGCGCGCATGCGTCGAGAGGCCCTCAAATATGTACCTACCCCTGCCCAAAGACCCTTGTAGAC
      CGTCGCCTTGTGGCCTGTTCAGCACTTGTCATGTAGTTGGGGAGCGTCCTGTGTGTGCCTGCTTGCCAGACTACATGGGT
      GCTCCGCCCAACTGCAAGCCCGAGTGTATGACCAGTGCCGAGTGTCCTTCGGATAGGGCCTGTATAAACCAGCGCTGCAA
      AGATCCTTGTCCCGGAACATGTGGCTACAATGCCCGCTGTCGCTGCACGAATCATTCACCAATATGCAGTTGCTACGATG
      GTTACACCGGGGATCCGTTCCACCAGTGCGTTCCTGAAAGAAAACCACCACCAATAGCTGATCCCATTGTTCCGCCCAAT
      CCTTGTGTGCCATCACCTTGCGGACCCAACTCTCAGTGCCAGGTTTCAAGCAGTGGAGCAGTGTGCTCCTGCGTAACCAA
      TTACATAGGACGACCACCTGGTTGTCGGCCAGAGTGCAGTATTAATTCCGAGTGTCCGGCCAGAATGGCCTGCATCAATG
      CTCGTTGTGCCGATCCGTGCATCGGATCGTGTGGAAATAACGCACTCTGCCATGTCAGTCTGCATGCACCGGTGTGCATG
      TGTGAGCCCGGATATTCCGGCGATCCGTTCTCCGGCTGCTACAAGATAATTGAGACCCCGATTGAGGTAATCCAACCGTG
      CCGTCCCAGCCCATGCGGCTTAAATGCCCTTTGCGAGGAGCGGAATCAAGCCGCCGCCTGCAAGTGTCTTCCGGAATACT
      TTGGGGATCCATATGTCGAGTGTCGCCCCGAGTGCGTCATCAACTCGGACTGTCCCAGGTCGCGAGCCTGTGTCAATCAA
      AAGTGCGTGGATCCCTGTCCGGGAATGTGTGGTCACAACGCTCTATGCGCCGTCTTCAACCACGCTCCCAACTGCGAGTG
      TCTTCCTGGTTATACGGGCAACCCCATCGTTGGTTGTCACATAGTCCCTGAAAGTCCGCGCTATCCCGACCCAATAGTGC
      CTGAAAACCCTTGCCAACCCTCGCCCTGTGGCCTCTACAGCAACTGTCGCCCGGTCAATGGCCACGCAGTTTGCTCCTGT
      GTGCCCAGCTACATCGGCTCTCCTCCCAACTGCCGGCCAGAGTGCATGAGCAGCTCGGAGTGTGCGCAGGACAAGTCGTG
      CCTTAACGAGCGCTGCAAGGATCCCTGCCCAGGCACCTGCGGCAATAACGCGCTCTGCCGCGTAGTCAACCACAACCCCA
      TCTGCTCCTGCAGTCCCGGCTTCAGCGGTGATCCCTTCGTGCGCTGCTTCCCACAAGAGAAGCGACCGCCCATTACCCAT
      GACCGCATCGATCCGTGCGTGCCCTCGCCATGTGGGCCCAACTCTGAGTGCCGGGTGTCGGCCGCCAATGAGCAGGCTGT
      CTGCTCATGCTTGCAACATTACGTGGGTAGGGCGCCAAATTGCCGACCGGAGTGTACATCCGATTCCGAGTGCCCTGGCA
      ATTTGGCGTGCATAAATCTGCGCTGCCGGGATCCGTGTGTCGGTACCTGCGGCATACAGACCACCTGCCTTGTAAATAAT
      CATAGACCCATTTGCCGCTGCATTGACGGTTATGCAGGCGATCCATTCTCAGAGTGTAGTCCAAAGATTAATGTCCCGGT
      ACAAGTGGCACAGCCCTGCAACCCGAGTCCCTGTGGCGCCAATGCTGTGTGCAAAGAGCGCAATGGAGTGGGTTCCTGCT
      CCTGTCTACCGGAGTATAATGGAGACCCGTACACGGAGTGCCGCCCAGAGTGCGTGCTCAATAGTGACTGCTCGAAGAAC
      CGCGCCTGCCTCAACAACAAGTGCCGCGATCCCTGTCCGGGAGTCTGTGGCGTCTCGGCCGAGTGCCACGTGATCAACCA
      CGCCCCCAGCTGCAGTTGTCCTTCCGGTTTCACTGGAAATCCCTCGCAATTTTGTCGGGAGATACCAAGATTGCCCGCTC
      CCGTTGAACCATGTCGTCCTTCGCCCTGCGGACCCTACAGCCAGTGCCGTGAGGTTAACGGACATGCGGTCTGCTCCTGC
      GTTACCAATTATATTGGCACACCGCCCGCTTGTCGTCCGGAGTGCTCGGTTAGCTCCGAATGCGCTCAGGACAGAGCATG
      TGTGAACCAGCGCTGTGCGGACCCATGTCCTGGTACCTGTGGCAATGAGGCTATCTGCAAAGTGACCAACCACAACCCGA
      TCTGCTCCTGCCCAGCCGGCTACAGCGGCGATCCTTTCGTTCGCTGTGCGCCGTGGCAGGAGGAACCGGAGCAACCCAAG
      TCCAATGAAAATCCTTGTGTACCCAGTCCCTGTGGACGCAATTCCCAGTGTCGTGTCGTGGGCGAGACGGGCGTGTGCTC
      CTGCCTGCCAAATTTCGTGGGTAGGGCGCCAAATTGCCGCCCAGAGTGCACTATCAACACAGAGTGTCCTGCCAACCTGG
      CGTGCATCAATGAGCGCTGCCAGGATCCCTGTCCGGGATCGTGTGGCTTTAATGCTTTCTGTAGTGTTGTAAACCACTCG
      CCCATCTGCACCTGCGACTCTGGTTACACAGGTGACCCATTCGCCGGCTGTAACCCACAACCTCCAGCCATACCCGATGA
      ACGTCTGACTCCCTGCCAACCCTCCCCCTGTGGTCCCAATGCCGAGTGCCGTGAGCGCAACGGAGCCGGCTCCTGTACTT
      GTCTGCCGGAATATTTCGGTGATCCGTACAGTGGCTGCCGTCCGGAATGCGTGGTGAACAGTGATTGCTCGCGCGACAAG
      TCGTGTGTCAACCAGAAATGCGTGGACCCGTGTCCAGGTGTTTGTGGCTTGAACGCCCAGTGTCGTGTGTCCAATCATCT
      TCCCAGTTGCTCATGCTTGGCTGGATACACCGGAAATCCGTCGAGCGCGTGCCGTGAAATTCCCCAGTTGCCCCCACCAC
      CCGAACGGGATGAGAACCCCTGTAGACCATCTCCCTGTGGTCCCTATAGTCAGTGCCGCGAGGTCGACGGCCATGCCGTG
      TGCTCCTGCCTTCAGGGCTTCATCGGATCAGCTCCCAACTGCCGGCCCGAGTGCATCATTAGCTCGGATTGCGCCCAAAA
      TCTTAACTGTCAGAATCAAAAGTGCGTGGACCCGTGTCCGGGCACTTGTGGCATCGAGGCGCGCTGCCAGGTCATTAACC
      ACTATCCCGCATGCTCCTGTGCCCCAGGTTTTACCGGAGATCCCTTCAACCGGTGCACCAAGATATTGTTGGAGCCCCCA
      CCCACCGAAAAGTCTGGTAATCCCTGCATCCCATCACCATGCGGACCCAACTCGAAATGCCTCGATGTCCGTGGTTCGCC
      TGCATGCTCCTGTTTGCCCGACTATCTGGGACGTCCGCCAAACTGCCGGCCCGAGTGCCTCAGTAGTGCCGACTGTCCGG
      CTAACCTGGCCTGTGTGAACCAGCGCTGCTCGAACCCATGTATCGGCGCTTGCGGCCTGCACTCCGTGTGCACGGTCATC
      AAGCACCGACCAGCATGCGAGTGTGTGCCAGGTTACACCGGAGATCCCTTCTCAGGCTGTGCGATCGTACAGCAAATCGC
      CCCGCCGGACGAGACAAGAAATCCCTGCAATCCTAGCCCCTGCGGAGCAAATGCCATTTGCCGGGAGCGCAATGGAGCTG
      GCTCTTGTGCCTGCCTGCCCGAGTACTTTGGTGATCCGTACAGTGGTTGCCGACCGGAATGTGTCCAGAACGACGACTGC
      GACCGCTCGCGTGCCTGTATCAACAACAAGTGCCAGGATCCTTGTCCCGGAGCCTGCGGCATCAACGCTGAGTGCAGAGT
      TTTGAATCACGGACCGAACTGCAACTGTTTCGATGGCTATACTGGAGATCCGCATCGCTCGTGCTCGTTGATCGAGGTGG
      TCACTATTCGACCGGAGCCATGCAAGCCATCACCCTGCGGACCGTACAGCCAGTGCTTGGACACCAACAGTCATGCAGTG
      TGCAGCTGCTTGGAAGGCTACATTGGTGCACCGCCCAGCTGCAAACCGGAATGTGTGGTCAGCTCGGAGTGCCCACAAAA
      TAGGGCTTGCATTAACCAGAAGTGCGAGGATCCTTGTCGAGGATCGTGTGGCAATAATGCTAAATGCCAAGTGGTCAACC
      ACAATCCCATCTGTACCTGCCAGCCTGGCATGACAGGTGATCCGATATCGGGATGTGAGCCCATGCCCGAAGTCAAGAAC
      GTGGAGAATCCGTGTGTGCCGTCACCATGTGGACCCAACTCTGTTTGTCGACAGATTGGAAACCAGGCAGCATGTTCCTG
      TAACGCTGGCTATATTGGACGCCCACCCACTTGCCGACCGGAATGCACAAACAATGACGAGTGCCAGAACCATCTTTCCT
      GTCAGCAGGAGCGCTGCGTGGATCCGTGCCCCGGATCGTGTGGTAGCAACGCCATCTGCCAGGTGGTGCAGCACAATGCT
      GTATGCTCCTGCGCCGATGGATACGAGGGAGAGCCACTCTTTGGTTGTCAGCTGATTCCAGCTGTGACGCCCACCGAGTC
      ACCATCCTCGCCCTGCGAGCCATCACCATGCGGTCCTCATGCCGAGTGTCGTGAAAGGAATGGAGCTGGAGCTTGCTATT
      GTCACGATGGATTCGAGGGTAATCCCTACGATGCCCAACGAGGATGCCGACGAGAGTGCGAGAATAACGATGACTGTACT
      GCCGTCCAAGCCTGCTCTCGATTCAAGTGCGTCGATCCCTGCAACAATATTTGCGGAGACTATGCCATTTGCACAGTCGA
      CAAACATGTGCCCACTTGTGACTGCCCGCCTGGATACACTGGAGATCCGTTCTTCAGCTGCAAACCCGTGCCGGTCACAC
      CGCGTCCTCCGCTCAACCCATGCAACCCATCTCCATGTGGACCCAACAGCAATTGTCGGGCCATGAACAACCAGGCAGTG
      TGTTCCTGCCAGGCAGGATTCATCAACCAGCCACCCAACTGCAAACCGGAATGCGTGGTCAGTGCCGAATGTGCTCCGGA
      AAAAGCATGTGTACACAAGAAGTGCGTTGATCCCTGTCAGCATACCTGCGGTATCCGGGCCATCTGCACCACCAAAAACC
      ACAGCCCCATCTGCACGTGTCCCCGAACAATGACTGGAGATCCCTTCGTTGAGTGCACTAGAGTTGCAATCACCAATGAC
      AATACGACACCGTCGCCGGCTCCAGCATCCTGTGTGCCTTCGCCTTGTGGACCCAATGCCAAGTGCCAGATCGTGGGCAA
      TAGTCCGGCATGCTCCTGCCTGCCGAACTTCATCGGGGCTCCACCCCGCTGTCGCCCGGAGTGCGTCTTGAACTCGGAAT
      GTGGACCCACAGAGGCGTGCATAAACCAAAAGTGCGCAGATCCATGCTCTGGATCGTGCGGATTTGAGGCCAAGTGCCAT
      GTGCTCAATCACCTGCCCATTTGCAACTGCATTGAGGGTTACGAAGGTGATCCGTTCGTGCGTTGCACCAAGAAGGAAGA
      AGATAGATCTCCTCCACCCCCGAATGACCCGTGCAACCCGAACCCGTGCGGACAAAATGCGGATTGCTTTGCCGGAGAGT
      GCCGCTGCCAAAATAATTACCAAGGCAATGCCTACGAGGGATGTCGTCCTGAGTGCACGCTCTCAGCGGACTGTCCAAGG
      GACAAGGCCTGTATGCGAAACCGTTGTGTGGATCCCTGTCCAGGAATCTGCGGTAACAATGCTGTGTGCGAGGTGATGAA
      CCACATACCGGTGTGCTCCTGCGTCAAGGGTTATGAAGGTGACCCGTTCGTCAACTGCCGCGTGAAACCCGTCGTGGAGG
      ATCCTATTATTGAGGCCTGCTCCCCATCGCCATGCGGTTCCAACAGTCAGTGTCGCGACGTTAACGGCCATGCGGTTTGC
      TCTTGCCTGGAAGGTTATATCGGAGCACCACCCCAGTGCCGTCCCGAGTGTGTGGTGTCAAGCGAGTGCTCCGCCTTACA
      AGCCTGTGTCAACAAGAAGTGCGTAGATCCATGCGCCGCTGCTTGTGGTTTGGAGGCCCGCTGTGAGGTCATCAATCATA
      GTCCGATTTGTGGCTGCCCACCTGGCCGAACTGGAGATCCGTTCAAGCAATGCGTCGTCCTCCCACCGATTGCTGTTCCA
      GACGTAAAGTCACCTCCCCAAGATCCCTGTGTGCCATCCCCCTGCGGACCCAACTCGATCTGTAAGAATGATAGGAATGG
      CCCCGTCTGCCAATGTCAACCAGAGTTCTTTGGCTCGCCGCCCAACTGTCGACCCGAGTGTATCATTAATCCGGACTGTC
      AATCTACACAGGCGTGTATCAACAACAAATGCAGCAATCCATGCCCAGAATCATGCGGAACCAATGCGGAGTGTCGTGTT
      ATTGGACACGCTGTGTCCTGCTCTTGTCCAACAGGATACGCCGGCAACGCTTTCGTACAGTGTGTACCGCAGCAAGAGGA
      GCCACCGAAGCCGTGCCAGCCATCGCCATGTGGTCCAAATGCCGAGTGTATTGAACGGAACGGAGCCGCAGCCTGCAAAT
      GTATTGATGAATACCAGGGTAATCCGTACGAGGGTTGTCGTCCCGAGTGCGTACTGAGCTCAGATTGTCCTACGGACAAG
      ACGTGCATACGCAACAAGTGCCAGGATCCTTGCCCAGGAATCTGTGGATTGAACGCCCAGTGCTATGCTGTGAACCACGT
      GCCCAACTGTGTTTGCAACGATGGCTATACTGGTGATCCGTTCGCCAGTTGTCGTCGAGTGGAGGTCACAACTCCATCAC
      CAGTTTCGGATCCTTGCATTCCATCTCCTTGCGGAGCCAATAGCAAATGCAGGGTCGCAAATGGCTTAGCCGTTTGCTCA
      TGCATGGAAACATTCATTGGAGCCCCACCAAATTGCAAACCCGAGTGCACGGTTAATGCCGAGTGTCCTTCCAATAGGGC
      GTGCCACAAGTTCCGTTGCGCGAATCCTTGCGCCAAGACGTGTGGCCTGAATGCCAAGTGTGAAGTGATCAACCATAATC
      CCATCTGTAGTTGCCCTCTGGACATGACGGGTGATCCATTTGCTCGCTGCTACCCAGCTCCCCCACCGCCGCCACCAGGA
      CCCAAGGATGAGCCCGTTAGGAGACCATGTCAACCATCACCATGTGGATTGAACTCGGAATGCAGAGTACGTGACGAGCA
      GGCCTCGTGCTCTTGCCTACCCAACTTTATAGGAGCACCACCTAACTGCCGACCCGAATGTGTTGTGAACACGGATTGTT
      CGCCGGACCAAGCTTGCATTGCCGAGAAGTGCCGTGATCCCTGCGATGGATCCTGCGGAGTCGACTCCGAATGCCGTGTT
      CAGAACCACTTGGCCATCTGCACCTGCCGTGGAGGATTCACCGGTGATCCGTTTGTTCGTTGCTTCGAGTTCGTCGAAGA
      GACCACAAAGTCACCGCCACTCACACAGGATCCTTGTGATCTGCAGCCATGCGGATCGAATGCCGAGTGCCGAAACGGTA
      TCTGTAGCTGCCTCGCGGACTACCAGGGAGATCCCTATACCGGCTGTCGTCCAGAATGTACATTGAGTACTGATTGCGCA
      CCTACCAAGGCTTGCTTAAACAAGAAGTGTGTTGATCCTTGCCCAGGAGTATGTGGGCAGAACTCGCAGTGTGATGTTTC
      AAACCACATACCGATTTGCAGTTGCCTGCAGGGCTACACGGGCGATCCGTTTGTTCACTGCCGTCACGAGACGCCAGTGG
      CCAAGGATCCGTGCCAACCGAACCCATGCGGACCCAACAGCTTGTGCCACATATCCGGACAAGGACCAGTCTGCGCCTGT
      CAACCGGGAATGCTGGGCTCACCGCCCGCCTGCAAACCGGAGTGCATTGTCAGCTCCGAGTGCTCGTTGCACACTGCCTG
      TGTGAACAGGAAGTGCGTGGATCCTTGCCCCGGAGCATGTGGGCAATTTGCTCGCTGCCAGGTGATCAACCACAACCCGT
      CCTGCTCATGCAACACGGGATACACTGGCGATCCGTTTACCCGATGCTATCAGGAGGAACGAAAACCACCGACGACGCCA
      GATAATCCTTGCCAGCCATCTCCTTGCGGACCCAATTCCGAGTGCAAGGTGCTGAATGGAAACGCTGCCTGCTCGTGTGC
      GGCCACCTTCATTGGAACGCCACCAAGCTGCCGACCCGAATGCTCCATCAATCCAGAATGTCCACCAACCAAGGCCTGTA
      TCCGCCAGAAGTGCTCGGATCCGTGTGTGAATGCCTGTGGATTTAATGCCCGCTGCAATGTGGCCAATCATCAACCCATC
      TGCACATGCGATGTGGGCTATACTGGAGATCCGTTTACGGGCTGTCAGAAGGAGCAAGACGAACCAAAGCCACCACCAAC
      TCCCAAGAATCCTTGCTACCCTTCGCCCTGCGGAACCAATGCTGTGTGCCGCGTTCAAGGAGAGAACTACGTCTGCGAGT
      GCAGCCAACTGGAGTACATCGGCAATCCCTACGAGGGTTGTCGCCCCGAATGTGTGGGCAACTCCGAGTGCCCGGCCAAT
      CAGGCTTGCATTCGCAGCAAGTGCCAGGATCCTTGTCCAGGAGTTTGCGGACTGGAGGCCATTTGCACCATGAACAATCA
      CATACCGATCTGCTCTTGCCCGCCTGGCTACACTGGCAACGCGTTTGCCCAGTGTACGCGTCAGGTAACACCACCTCCTC
      CCTCGGATCCTTGCTACCCGTCCCCATGTGGACCCAATTCGATATGCCGAATTCAGAACGAGAAGGCCGTGTGCGAGTGC
      CTGCCCGGATTCTTCGGAAATCCGCTGGCCCAGGGATGTCGCCCTGAATGCACCCTGAGTTCGGACTGCGCCAAGGATCG
      GGCATGCATCAACTCCAAGTGCGTGGATGCCTGCGTGGGAGAGTGTGGATTCGGAGCTGTTTGCCAAACGATCAACCACA
      GCCCGGTGTGTAGTTGCCCTGCCAACATGGTGGGCAATCCGTTCGTCCAGTGCGAGGAACCACGCCAGGCTGAGCCTATC
      GATCCCTGCCAGCCTTCACCGTGTCGAAGCAACGGAATATGTCGCGTTTACAATGGAGCTGCCACCTGCAGTTATCCGGA
      ATGCGTTATCAACGAGGATTGTTCCCGCGACAGGGCGTGTGTTAGCCAAAAGTGTCGAGACCCTTGTCTGAATGCCTGTG
      GCATCAATGCCATTTGTCGGGCCATCAACCACAAGGCTGTTTGTAGCTGCCCACCGGAGTTCTACGGATCTCCGTACGCT
      CAATGTCTGAGGCAGCTACCGGAGCCAGAGCCCAAGCCGGAATGCATCAGTGACGGTGATTGCACCAATGACAAGGCCTG
      CATCAACCAAGTTTGCCGCAATCCATGCGAGCAATCGAACATCTGCGCCCCACAGGCGCGTTGCCATGTCCAGCTCCACC
      GGCCATTGTGCGTCTGCAATGAGGGATATACTGGAAACGCCTTGCAGAACTGCTACCTTCTGGGATGCCGATCGGATGGT
      GAATGTGCCGCCAACGAGGCTTGTGTTAACCAGCAGTGCGTAGATCCATGTGGTTTCACACAGTGCGGAACGGGAGCCAT
      TTGTCGGGCTGACTTCAATCACCGAGCTAGGTGCCATTGCCTGGACGGATACCGCGGCAATCCTCTGGTGCGTTGTGAAC
      GTCCAGAGTGCCGATCCGATGATGAATGTGCCTTCCACCTCGCCTGCCGCAATGAACGCTGCGAAGACCCGTGCAACTGT
      GGCATCGGAGCCCAGTGCCGCGTGGAGAACCATCGTGCCCAGTGTCGTTGTCCAGCTGGCTTCAGTGGCAACCCGGCAGT
      AAGATGTGACCTTGTGCCAACACAACCGGAGGGCTGCACCATGGATGCCGAGTGTCCCAGCAAACTGGCCTGTTTCGGCG
      GCGAATGCAAGAACCCGTGCGATGTCACGCATCCGTGTGGCGCCAATGCCATCTGCGAAGTGGTCGACACACTGCCTCTG
      CGCACCATGATGTGCAGTTGTCTACCTGGCTATGTGGGTGAAGCCGACATTGGATGTCACAAAGAACCCCCTCGTGATCA
      GGGCTGTACGTCACATGATCAATGCCAGGATACGGAAGCCTGTCGTGGCGGAAACTGTGTCAATCCCTGCCTGGATGCAT
      CGCCTTGTGCTCGAAGCGCCCAGTGTTTGGCCCAACAACATCGCGCCATTTGCAGCTGTCCCGAGAGGACACAGGGAGAT
      CCATTCACCAACTGCTACGAGCCACCTGAAATCAAGACTGGCTGCACCCACGATTCGGAATGCCAGCCGACCACGGCCTG
      CATCAATAAACGCTGCCAGGATCCTTGTGCCGAGGCCAACCCATGTGCCGGAAATGCCGAGTGTCGCGTACAGAACTCCC
      GACCTATTTGCTTCTGTCCAGCTGGTTGGGGTGGTGACCCACAAGTTCAATGCTACAAACCTGAATGCAAGATCAACGCC
      GACTGTCCGTATGACAAGACCTGTTTGAACGAAAACTGCGTGGATCCCTGCACTCATGGCCAAGTGCGTTGTGGCAATGG
      GGCCCAGTGCCTGGCTCAGAACCACCAAGCTGTGTGCATCTGTCCAACCGGAACTCAGGGAAATCCATTCATCTCCTGCA
      TCACTGGACACTGCCAGTACAACGAGGATTGTGCGGATCACGAAGCCTGCGATCGATTGAATCGCGTTTGCCGACCGGTT
      TGCGATCAGGAGACCTGTGCCCTAAACGCCATCTGTGTGGGTCGTCGCCATCAGCCGCAGTGCGAGTGCCGACCCGGTTA
      CCAGGGCAATCCGCATGTGCAGTGCGATATACCAGTGAAGACACCCAAGCCCCAGTGTATCCAGGATGCGGACTGTCCAT
      CGAAATTGGCCTGCATCAATGAGCGCTGCGCAGATCCTTGCGCCACGCCTCATGTTTGCACTCCACAACAGACTTGTACG
      GTTTTGGATACCCTTCCAAAGCGAGCCATGGCATGCAAGTGCCCCGGCGATACAGTGACGGATATCTCACGCAACTGCGT
      GCCCATCACTGTGCCAAAGGTCATCTCCGGCTGCCAGCACAATTCTGAGTGTGCCAATACCGAGGTCTGTTCAAATGGAA
      ACTGTCTGGATGCATGCCGACTGGAGAGATGTGGCGTCAATGCCCAGTGTACAGCTCGGGATCACTATGCTCAGTGCAAC
      TGCCCTAAGGGCTTCCAAGGCAATCCTCGCATCGAATGCTACACTACAGAAGTTGATGTTCCACGAATCCCCAATCCTGG
      CTGCTCCCGCAACGATGATTGCCCCAGGGACCAGATTTGTCGCAACGAGATTTGCATCAGTCCGTGTGCCGCGGATGACT
      GTGGAATTGGTGCCTACTGCCATGTGCAGCAGCGAAAGGCCATCTGCCGCTGTCCACCTGGTTATACCGGTAACCCACAA
      GAGCGCTGCCTGCCACCTTCCGATGTGATACTGGTGGGCTGCAAGTCTAGCACCGACTGCCCCTCGAACGAGGCCTGCAT
      CAACACCCAGTGCGCCAGTCCTTGCAACTGTGGACCCAATGCCGAATGCACGGTGAAGAATCACCATCCGATCTGCTACT
      GCAAGCCTGGATTCTCCGGAAATGCCCAGTTTGGATGTGCACCCATTGGCTGCCGGTCGGATGACGAGTGCAGCGGAGAC
      AAGCAGTGTGTGAACCGCGAGTGTATCAATCCCTGCCTGGCCAGCGATCCGTGTGCCCTTAATGCCGAGTGTTACGGACG
      TAACCATCGCGCCAATTGCCGCTGTCCCGTGGGATTGGAGGGTGATCCGTTTGTGCGTTGTTTACGCCTGGAATGCCACT
      CGGATTACGACTGTGCATCGAACCTGGCTTGCGTGTCAAACGAATGTGTTAGCCCATGTGGTCAACGTAATCCGTGCGCC
      CAGAATGCCATTTGTCAGGCTCTGCAGCATCGCGCTGTTTGCCGTTGTCCGGATCAGTTGCCATTGGGTAATCCGTACGC
      TTATTGCGAACCCAGACCTGTTGAGCCCGTCTGCCGAGATGATGGAGATTGTCCAAGTAAGCTGGCCTGCATCGACGACA
      AGTGTCAAGATCCGTGCTCTGTGCTCTCACCATGCCATCCAACTGCTCAGTGCAGTGTCCTAAATAGCGTTCCAGTACGA
      ACAATGGTTTGTGAGTGTGCCGAGTACGAGGTGCCCGATGCCAGTGGAGCTTGCCGTAAGATGATGCCGCCTAGGCTTCC
      TGGCTGCGAGAGCGACCAGGACTGTCCCGACCAAGAGGCCTGCATACACGCTCAGTGCCGCAATCCATGCAACTGTGGAA
      CTAACGCCGTCTGCCAAGTGACGCAACATCGCGCCGTATGCAGTTGCCAAGATGGATTTGAGGGTAATCCCTATGCCTCC
      TGTCGCTCAATTGGATGTCGCGTCGACGGTGAGTGCGATTCGGGCAAGGCCTGCATCAATGGTGACTGCATCAACCCATG
      CCTGATCAACGATCCCTGTGGACCCAACGCCGAGTGCTATGTGCAATCGAACCGTGCCCAGTGCCGCTGCCTGAGTGGCT
      ATCGAGGAAATCCCTACGAGCGTTGTCGTGTCATTGGCTGCAGCAGCAACAACGACTGTCCCACAGACAAGACCTGCCAG
      AACGAGCAGTGCGTGAATCCCTGCGTCTACCACAACCCGTGTGCCCCGCGTGCTGAGTGCAGGGCTCAGAACCATCTGGC
      CGTGTGCCGCTGTCCTGTCGATTTCCTGGGCAATCCATACGTGGACTGCCGACCGCCGCCACAGCCCATCTGCCAGTTGG
      ATACCGACTGTCCTGGTCGCCAAGCCTGCATCAACGAACAGTGCGTGGATCCATGCGTTGTATTGGAACCGTGCCAACGG
      CCTGCCATCTGCGAGGTGACTCCTACATCGCCGGTGCGTACGATGTTATGTATTTGTCCGGATGGTTATGTTAGTAGAGG
      AAAAGGAGGCTGCAAGCCTACGCCGGGAATCAAGGAGGTTGGAGGTTGCATCTCGGACTCAGATTGCCCGACAGATAAGT
      CCTGCCTGAACAGCGTCTGTAGAGATCCTTGCAACTGTGGCTTGAATGCCGAATGCCGTATTAAGGACCATAAACCCGTA
      TGCACTTGTCGCCAAGGATTCGAAGGTAACCCTGAGTTTGAGTGCTCCAAGATCGAGTGCAGTATCAACTCAGACTGCCC
      GGGAACACATGTGTGCCGCAACCAGCTCTGCATTCCTGCCTGCCAGGGTGAACAGTGTGGATCCAATGCCCAGTGCTTGG
      CTATCGAGCATCGTGCGGTATGCGAGTGCATCCCAGGACATGGTGGAAATGCCAGGATTGCTTGTACTCCGTTGGGATGT
      CGCTCAGACGACGAATGTCCAACGGACAAGGCGTGCGTCAACGGTAAATGTAATGATCCTTGTACAACAACTGCTTTATG
      TGCCCAGGACGAGCTTTGCAAGGTGTATCATCACCGACCGCAGTGCGCCTGTCCACCAGGAACCGTGCCCGGAAAGAATG
      GCTGCGAATCGGAGCGACACATTCCCATCTGCATAAGCGATGCGGACTGTCCCAGCCAGAAAGCCTGTCTGCGCGGAGAG
      TGTGTGAATCCGTGCAATGCCACCCAACCATGCGGAGTCAATGCCTTCTGCAGTGTCCGTGATACCTTGCCCGTAAGGAC
      GATGATCTGTGAGTGCCTTGAAGGCTACACTGGCAACCCAGCCGTGCAGTGCGACAAGCGTTCGCTGTGCGTCATCGAGA
      AGGGCTTCGTTCGGGATGTGGATGGACAATGTGTTTGCCCACCGGGAACCGCTTTGGATATCTACGAATACTGCACCCCA
      TGCCGAGAGGAGCAAGGCTTCCGCATCGACGAGAGTGGTCACTGTGTGTGCGCCTTGGAGCGCGGAATGGTGATCGACGA
      GCGCGGCCGTTGCACTTGCCCCATTGATCTGGGCTACCGACTGACTCCACGTGGCGAATGTCAGCCAGAGGAGCCGCCAG
      AGTGCACGAGCAATGATCAGTGCGCCGACAACCGATTCTGCAACCTAGACACCAAGACCTGTGAGGATCCCTGCCTGACC
      AAGGTGTGCGGAGTGAATGCCTTCTGTAACGCGGTGAATCACCGAGCCCAGTGCCAGTGCATCACCGGTTACACGGGTAA
      TCCGGATCTACACTGCAACCACACAAACTTCCGAACCGATTTCCCACGACCCGATATGGTCGTCAGTTGTCTTGCCGATG
      GAGTTCAAGTTGAGATCCACATCACCGAACCAGGATTCAATGGAGTGTTGTACGTTAAGGGACACAGCAAGGACGAGGAG
      TGCCGTCGGGTGGTTAACCTGGCTGGCGAGACTGTTCCGCGTACCGAGATCTTCCGTGTCCACTTCGGTAGCTGCGGCAT
      GCAGGCTGTAAAGGATGTGGCAAGCTTCGTGCTGGTCATCCAGAAACATCCCAAGCTGGTCACCTACAAGGCCCAGGCCT
      ACAACATTAAGTGTGTCTACCAGACTGGCGAGAAGAATGTTACCCTAGGATTCAACGTATCCATGCTGACGACTGCCGGA
      ACAATTGCCAACACAGGACCGCCGCCGATCTGCCAGATGCGCATCATCACCAACGAAGGCGAAGAGATCAACTCTGCAGA
      GATCGGCGACAATCTCAAGCTGCAAGTGGATGTGGAGCCAGCCACCATTTATGGAGGTTTCGCCCGCTCTTGTATTGCCA
      AAACCATGGAGGACAATGTGCAGAACGAGTATCTGGTCACGGATGAGAATGGGTGTGCCACGGATACCAGTATCTTTGGA
      AACTGGGAGTACAATCCGGACACGAACAGCCTGCTGGCCAGTTTCAATGCTTTCAAGTTCCCATCGAGCGATAACATCCG
      CTTCCAGTGCAACATACGAGTCTGCTTTGGACGCTGTCAACCCGTCAATTGTGGTGGCTACAACGCCTTCGGGCGGCGTC
      GCCGCTCCATAGCGGATAACTCCACCGATGCGACCGCCATTGCCACGAATTCGGGTGTGGAGGGTCAACTGCGCGAAGAG
      ATCACAATCTCATCAAATGCCATTTTGACATTCGAGAAGCGCAGCGGTCAAGGTCTCAATGATGCCAACATAAAACCGGC
      GGCTCAAAGGGTTGAGGATATCTGCGTATCTATGGTGGGGCTGATTATAGCACTGGTCATCACGGCACTGCTGGCTCTTG
      TGGCCGTTGCCGTGGCAGTTTCCTGCTGGCTAATGGCCTACAGGAGGAGGCCCAAGACCATTGCGCCCCTGCCCCATCCG
      CCAGAGTTCCCCAATCCGCTGTTCTCCAATCCCGACGCAGTGCCCGAGCCAACGCCGGATTACATATCCTAAACGTAACG
      TAACAATACACTGATACACAACACCTAGCTATATCTTTAGTATGTAAGAGAATCGAATGAAAATGAAAAAGAAAAAATTG
      TGAATATTTGAAAGGCAAGTGCAAAAGGTTATGAATTATGCAATACAGATCAAATCGCGAAAGATTATCAAGATTGAGGA
      AAAGAAAAACAAAAGTACAGTTGTGAGCTGAAAGTAAAGTCGGCTCCATTGGCCGTAAAACGAAACTATGAAAGATTGAA
      TTATTGTAAAAAGCAAAAAAGACGAAGCGAGAATCGCATGATGAATGCACGAAAGTAATTTAGTAGCTTAAGAAAATAAT
      TTTATTAATTGTAATAACGATTAGTATTCTCCTTCCTACTAACATGAGAATTCCGCGTAGTGTTTGTACGTTTAGCTGCC
      CCATAGAGACCACCAACTGCCAAACAGATGTGAGGGAATTCACCCATAGAGAGTGCAGCTACAAACGAATTCTCGTCCTC
      TAACGACAACTTCTTCATTAGTCGAGTACCAATATTAATTCTGTTATATATGTTTAACTAAAGACTTCCTATAAATATTT
      AGGGTGTGGGTAGTAGCAACGACACTTTGTATTATAGCACAGACACACGCACACAAAACTGCAACTACTTCCTGTAATTT
      AGATACCAACTCAACTCGCCCGTTAAAATTGAAAACTGCCTTTGATTTCCAACAAGAAAAACGAACAATGCACCCCAGAA
      TACTCTCTAGCATAATATATGTAAGAGATCGTTGGGCCCAGGTCTATAAGATACTTTTCCGCGTCTATAATCCATAACCA
      CTGGACAATATGCCAACGATTGTCCCAGTTGGATTGTGGGCAAGCTCAAGAGTCAAAACACACACACACACACACACAAA
      TCTCGAAGAAATCAGACCACTCTAAACAGCTTATAGACGTGGTAACAGTTTCATCTGGATCTAGGCACCAAATCGTTGAG
      GGAACATAACTATAACTGCCACTGAGGCGTCATCAGCGCACAAAAGATACTTATCTATTGCATAGGAAATACTAGGTTTG
      TTTTAATTTTAATCGCAACACCGACTAATGGAGGATTTGATTTTGACCACTGTCCCTCGATCGCTCGATCACTTACTTGT
      ACTACACTCTACTATGATTAACAATTATTTTTGTAGTTTTATAGTCAATTAATATTAAATTGTTGTGATTGTTTTTAATG
      CAAAAGAGATACTTCCACTAACTTACTAATATGTAGAGACAAAAGTATAGAGCGTACTTAAAAAGGCAACGAACCAGCGC
      CCTTTTCCCTGCCCCTGCACCGTTCCCATGCCATTCTCCATCGGGAACAGCATGCAACTGTCAACGCGCCGGAAACTATG
      CAGCGAATTTCCGTTTCCGGCGCCCGTTTCACAGTGCATGTCTTTTCCCGATGCGATGATAGCTGGTGGGATGGCGGGTT
      TGCGGAATCGGGCCTGGATAAATAAATTATTAAAAATGAAGTTTTAAATTAATATTATTAAACGTAAACAAAATGTATAG
      TCACTACTTTAAGAAGAAAGAGAAATTTTCTTTATAGTAAAATACCATACAAAATAAACTCGCACTCAGACACGTACACA
      AAGAGACAGAATTTGTAAATAATACACAGGCAAACTCTATGGTATTTTTAAATAGCGCATTATTGTGTATAGGTTTCTGC
      ACCTCGACTCCCAAATCCGAACTAAATCGCAGGCTAACCCTAACCCATGCCAGGCATAAAATTATTTTCTTAATTCCATA
      GCCAATATGCATATGCAAGCAAGTGCACAAACTAGCAACCGCCTCGTTCACAATTACCACACACTTTTATTTTTCTTCAC
      AAGAACCGCTTCAAAATCGTACCCTAAATAGAGTTATATTGAACATAGACAAAACTTTTGCACTGGCAGCAAATATAAAT
      GAGAAAATAATAATGAATAAGAATGGCTCTTATTGTAAAAAGAAAGCAATAGTTAAATTGTACTTATAAAACGTGTATTT
      AATAACGAGAAACGAACATAATTGTAATCGCTTATTATAAACTAATAAATAAATAAATAAATAAATAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0332355
      59206
      FBtr0305141
      47440
      FBtr0305145
      26263
      FBtr0332343
      68745
      FBtr0332344
      62656
      FBtr0332345
      71382
      FBtr0332346
      69016
      FBtr0332347
      56449
      FBtr0332348
      69435
      FBtr0332349
      67506
      FBtr0332350
      63747
      FBtr0332351
      56567
      FBtr0332352
      47000
      FBtr0332353
      54801
      FBtr0332354
      50529
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0293672
      15105
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0304632
      19560
      FBpp0293671
      15638
      FBpp0293675
      8579
      FBpp0304620
      22743
      FBpp0304621
      20710
      FBpp0304622
      22949
      FBpp0304623
      22830
      FBpp0304624
      18641
      FBpp0304625
      22300
      FBpp0304626
      21657
      FBpp0304627
      20404
      FBpp0304628
      18014
      FBpp0304629
      14825
      FBpp0304630
      18095
      FBpp0304631
      15998
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      5' UTR based on RNA-Seq data.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dp-RJ
      dpy-RJ
      Secondary FlyBase IDs
        References (0)