General Information
Symbol
Dmel\Ptp99A-RG
Species
D. melanogaster
Annotation Symbol
CG11516-RG
FlyBase ID
FBtr0303454
Feature type
Associated gene
Evidence Rank
Length (nt)
5793
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 38 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTTCTCCAAAGCACGCGCGTGTATAAGCACGTATGTAGATTCATAGATACATATATCGGTAGCACCAAAAAAAAAAAAA
        AAATAAAGAATCGAGCAAACCAACCGCACAATAATAAACCTTATCAATAAACAACGCTGCGAAAGAGAAGCGACAAGTGA
        CGAAAGACATAGCCAGTAGTGTGCTCGTTTCGTCACAACAAGAGCAGCCTCATTGAGGCAAATTCGTGTGACGGCGTGGT
        GTTCGTAGTTATTGCGTACTATTTTTGCAGTGAACTGGCGACACTGCAGTTGCCAATATGACGAGTGACGTAATTTGTGC
        AAGTATGTAGGCGCAGATCGCGGGTACACGCAGCGAAAAAGGGAGCCACACTCTACACACATATGTCGTCAGGTGGCGGG
        GAAAAGCGCTGCAGCAGCCCCATGCTGCATGCCACATCGGAAATCGGTGGTGCAACTACTGCAACGCCGCGCCTGCTGCG
        CCGCAAGTCGCAGCGCGGAAATTGGTTTACAAAGTGCTTCCATGCGGCCTACTACTATCTGGACGACCCGCCACACCATC
        CAAATGCCCCGCAGGTGGACTGGGAAGTGCCCGTTAAGATCGGCGACGAGATCCGAGCGGCTGTGCCCGTCAACGAGTTC
        GCCAAGCACGTGGCTTCCCTGCACGCGGACGGGGACATTGGATTCAGCCGGGAGTACGAGGCCATCCAGAACGAGTGCAT
        CAGCGATGATCTGCCGTGTGAACACTCGCAGCATCCGGAGAACAAACGCAAGAATCGCTATCTCAACATCACGGCCTATG
        ACCACAGTCGGGTGCATCTGCATCCCACACCGGGACAGAAGAAGAATCTGGACTACATCAATGCCAACTTCATCGATGGC
        TACCAGAAGGGACATGCCTTCATCGGCACCCAGGGTCCATTGCCCGACACCTTCGATTGCTTCTGGCGCATGATCTGGGA
        ACAGAGGGTGGCCATCATCGTGATGATCACCAATCTTGTGGAGCGCGGGCGGCGCAAGTGCGACATGTACTGGCCGAAGG
        ATGGGGTGGAGACCTATGGCGTAATCCAGGTCAAGCTCATCGAGGAGGAGGTCATGTCCACGTACACTGTGCGCACCCTG
        CAGATCAAGCACTTGAAGCTCAAGAAGAAGAAGCAGTGCAACACCGAAAAGCTGGTCTATCAATACCACTACACCAACTG
        GCCCGACCACGGAACACCCGATCATCCCCTACCCGTGCTTAACTTTGTCAAGAAATCCTCGGCCGCCAATCCCGCAGAGG
        CTGGTCCCATAGTCGTGCACTGCAGCGCTGGCGTCGGTCGCACTGGCACATACATCGTCCTGGACGCCATGCTCAAGCAG
        ATCCAGCAGAAGAACATCGTCAACGTCTTTGGCTTTCTGCGTCACATTCGTGCTCAGAGGAACTTCCTGGTGCAGACCGA
        GGAGCAGTACATATTCCTGCACGACGCTCTGGTGGAGGCCATCGCCTCGGGGGAGACCAATCTGATGGCCGAGCAGGTGG
        AGGAGCTGAAGAACTGCACTCCCTACCTGGAGCAGCAGTACAAGAACATCATCCAGTTCCAACCGAAAGACATACACATT
        GCATCCGCCATGAAGCAGGTGAACTCGATCAAGAACCGCGGCGCCATCTTCCCCATCGAGGGCAGTCGGGTGCACTTGAC
        GCCCAAGCCGGGCGAGGATGGCAGCGATTATATCAACGCCTCGTGGCTGCACGGCTTCCGGCGACTGCGGGACTTCATAG
        TCACCCAACATCCCATGGCGCACACGATAAAGGACTTCTGGCAGATGGTCTGGGACCACAATGCGCAGACCGTCGTGCTG
        CTCTCATCACTGGATGATATAAACTTTGCACAGTTTTGGCCAGATGAGGCCACGCCCATCGAGAGCGATCACTATCGCGT
        CAAGTTTCTGAACAAGACCAACAAGAGCGACTATGTGAGCCGCGACTTTGTCATCCAGTCGATACAGGACGACTACGAGC
        TGACGGTCAAGATGCTGCACTGTCCCAGTTGGCCAGAGATGTCCAATCCCAACAGCATCTACGACTTCATCGTCGATGTG
        CACGAGCGCTGCAATGACTATCGCAATGGACCCATCGTCATTGTGGATAGATATGGTGGCGCCCAGGCGTGCACCTTCTG
        TGCCATCTCCTCGCTGGCCATCGAGATGGAGTACTGCAGCACGGCGAATGTGTACCAGTACGCGAAGCTGTACCACAACA
        AGCGACCCGGGGTGTGGACATCCAGCGAGGACATCCGCGTCATCTACAACATACTTTCATTTTTGCCTGGCAATTTGAAC
        CTGCTGAAGCGCACGGCGCTTCGGACTGAATTCGAGGATGTGACAACGGCCACGCCGGATCTCTATAGCAAAATATGCAG
        CAATGGTAATGTTCCACAGCATGTCATACTGCAGCAGCAGCAGCTGCACATGCTGCAGTTGCAGCAGCAACACCTAGAAA
        CACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAGCAACAACAGACAGCACTCAATGAGACAGTCAGCACA
        CCAAGCACCGATACTAATCCAAGCCTCTTGCCCATTCTGTCATTGCTACCGCCCACAGTCGCTCCTCTATCCTCCAGTTC
        ATCCACCACACCACCACCACCAAGTACTCCAACACCACAGCCCCCACAAACCATCCAACTGTCATCGCATTCGCCATCCG
        ACCTGTCCCACCAGATCTCATCCACAGTCGCCAATGCAGGATCACCAGCAACTGCAAGTGCAGGCGCAACACCAACGACT
        CCAATGACACCGACAGTCCCACCCACAATACCTACAATACCATCACTCGCATCCCAGAACAGTCTAACCCTTACTAATGC
        CAATTTCCATACTGTTACTAATAACGCTGCTGATCTGATGGAACACCAACAACAACAAATGCTGGCCCTGATGCAACAAC
        AAACGCAACTGCAACAACAATACAACACGCACCCGCAACAACATCACAACAACGTCGGTGACCTGCTGATGAACAATGCG
        GACAACTCACCAACCGCTTCACCAACGATCACCAACAACAATCATATAACCAACAACAACGTCACAAGCGCAGCAGCGAC
        AGATGCTCAAAACCTAGATATTGTAGGCTAAACTAAAGATAAATTTACAGAGAGGGAATTTAAATCATTTTATAAATGTT
        TAAATATAAATACTTAAATTTAAACCTTACACCTACGTACATAGCGATGTATTTATTAAAGTCTAAGTCGTTTAAGTGAG
        AACAGAGCGTCTAGCGCTGTGTCCATAAATTATTCAACAATTCGTTTGCCCTGTAAGCTCATATTTTACTTTAACTTACA
        CACCCACACTCAGTTGTTTCCCCCAAAACTATCTAAATTATTTTGTCTTATGTAGTAGTTTTTATATCGTAAACATAGGT
        TTTTATACACCATACTTTACCCACATTTAGTCACGAGGGAAAAACAAAACAAGAACGAAAGTCAAAAGCCGCAGTGAAGA
        ACAAGAATAATCGCAAATCTAAAGTGGAAACGTAGTGGAAATGCACAAATCGAACAAGTAGAGTTAATAACATATTTGTC
        TAATCATTTAAATACGCTGATTACACATAACTAACGTTAATGCAGGCTAATGCTGCACACACTTGTGCCATGATTTTTTT
        AAGCTCTCCCAAGCAAATTCCTATTAAAGTAATGAATATTAGTTGTTGAATTGAATTAGTTGATTGAGCAATCAATTTGC
        ATTTTAATTCGAATCGATTCAGTCCGTCCTAGTATCTGTTATTCTTTTCATTTTGCCTTCCTAACAATTGGTTCCACTTT
        AAGACAGTTTAATGCAAAATGACAAACTTAAGCGAACCTAGCTACAAATTAATTGCGAATTTAGTGGGCACTAAGCCGAA
        TTACCGAGCACTCTACACCACCCACACCACACACATCACTGTAAATCCCAATCAAAGCTAAGTAAATCACACGATTTCCG
        CACAAAGCACAAGAGCATCACGAAAATTTGTAAATACAGCTTAGATCAGATAAAAGATACTGTATAAATGTCAGAAGTCA
        GAGAACCCTTCACACTCTGCAAAGCTAATAATATTGTAAAAATAAAAACTAATTTAAGCGAACGCGACAACTATAAGTGT
        AAATCGGCAAAGTAGTCGCAAGCAAAGTATTATTAAACTATATGATACGTGTGAAAAGTGAGATAAAAGAAAATCCCAAT
        GAAAACCCAAGCTTAAGTTTTGTTTTCCTCTATCGATGCGTAAATCTAGCCTGTACAGTTCTCTTAAAGTTAGACCCGAA
        TGAATTATGATTAAACCTAGCACTCTGAATGGCCATAGCCAAATGGTTTGGAGCTCTCCAAATCGGGCAGTTAGAAAGTA
        TATACCCCCCACAAGTAATTTAGTGAATATTTTTACATTTTATATGTAAAGTATTGGTGGAAATGAAGAACATACGAAAC
        GATGAACAAACATGTTTTAAAGACTGGTTTTTTGTACACTTTAACTTGAATAAGCATGCATACTGATACTGATTATGTAA
        ATGATTATTATGAACGAATGTCAAAGGTCCTTCAGTTGCCCCTCCCCGCCCCCGCAAGACCTGTCCCGAATGTAGTTTCC
        ACTCAATCGCATGTAGTCAGACTACTTGCGGATGCAGACCGAGGATTTGGGAGCACACTTCAATATCCGATCGTATCAAT
        CCAATCATTTGTCAGCTGATACCAAATAGGCGGCTCTACATGTTAAACAACCAACTAATGACCAATTTTGTGAGATTATG
        TTTCTTAGGCACTAGACCCGACTTAGGCTAAGACTACTTAAACGCTAGAAGGGCTTGTAAATTTCTCATACCGACACCGG
        CGGTGGTAACAAATGCTTCATCTGTAATATAACGACAAGAATCATATTATTTCGATACAATACTAAGGCAGGCAATACTA
        TGCATTTTAACTGTTAAACACACATAAATAGTAGTGCGTATGATGCAACTATAGGTGGATATTTCCATGCATTATGTACA
        TAATGTTGTAAGTGAAAAGAAAGAAAGAAAGAAAAGCTTAATCAACTGCATTGCGAATGAAGCAACGAACACCTTTTGTG
        TGATCACACAGAGTTCTACCGAAATCTCCCAATTAAATGTGCACACTCTTTTCGAGCAAATGGAATCCTTTCCGCGACTA
        AACTACCTTCACACATTAACTAAAGTAATTGAGAACGATAGAAACAAGGCCACAGATACAACAGATGATTATCTCTAATT
        GACGGTGTTATGCAATTTATAAATGTGATGAATGTCAAAGTTAAGCGTAAACAATTTAAAAGCAAGCGAAGAAAATACAA
        AAACACAAAAAAAAATACAAATAAAAATAAATATAAATATAAATATAAATATAAACAAACGATTCATGAGAAAGAGCTGA
        ATGTAGCGAGAACTTAAGTATCTAAGCATGCCCACGATTTTAGAGCTAAGCAAATAGATGAAGATACAAATACAAATACA
        AATACCCAGAGGCAGACCATAGGTTTTAAAGAACGAACGAAGCATTTGCCCCACATCCTGACAGGTTACCGCAGCTTGTA
        GAGGCCATTGCAGCCGGAGGAGTCGCCACAGAGATCGGACAAAATCTCGCGATAAACAGAATTAATGATATGAGTATATG
        TATGTATATGTATGTACACCTAAGCTAATCGTAAGCCAATGAAAGTTGAAATGGACTAAAGATACATGGAACAGACAACA
        TTGAAAGCGTCTAAATAAAGAACATCAAATTGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085422
        6223
        FBtr0085423
        4340
        FBtr0085424
        6268
        FBtr0303148
        7109
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0292507
        922
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0084791
        1226
        FBpp0084792
        1297
        FBpp0089274
        1241
        FBpp0292247
        1397
        Comments
        Extended 3' UTR based on RNA-Seq and/or EST data.
        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Ptp99A-RG
        Secondary FlyBase IDs
          References (0)