General Information
Symbol
Dmel\ReepA-RK
Species
D. melanogaster
Annotation Symbol
CG42678-RK
FlyBase ID
FBtr0302772
Feature type
Associated gene
Evidence Rank
Length (nt)
1931
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTCCGCCACTTCCACTCGGCCATCGCCGTTGTCGCCTTCCCAGCTGCCCAGTTGTATAGTTGCATAGTTGCACAATTCT
        AATTCCAATTCCGAATCGCCTCCTAGGGGAGGCGGCAATCTGGTGCAGACGATCAAGCGGAGCTACAGCCTCAGCGATCT
        TAGCGAACCGGATATGCATCGCACGCAGGACGAGCTGGACGACGTGATGATGTCCTCGATGACATCGTCGGCGGTGGTCA
        TGCGTTCCACAGCCACTGGCGCACGTCTACTGAGGCCAAGAAATCAGACGCCCGTGGGCAGATCCGGCAGCGGAACACGC
        CACTCCACGGGCATGTATTTTACGGAGGTGGATGTGACCGCCAAGAATGCCGGCGATTTCAACTACAACATTCGCAGCCA
        GGATGACATCAGCTCTGGCTACTCGAGCGCCGAACCTGTGAGTGGTCTCAGTCGCACCTCCTCCATGACAAACGCTTCCA
        AGGCTCGAGCCAAGTCCAAACGCAATGAGTTGCTGGAAGAGATGAGAGACGAGGTCTACTTAGACAACCAGCTGTATTTT
        CAAGGTGTGCAAAGGAAGAGCTCAGTTCCAGAAGCTGAAGAACTGAAAATAGTGGAGAGTTCTGAAAGCATCCAATCTCA
        GGAGTTGGAAAAGGTGCTGAAGGAGGAGAACATTGATGCAGAAGATGAGGCCTTTTTTGAAACCTTGCCTTTGATAGAGG
        AGCACATAAATGAAGTGGTGGCTAACTATGGAAGGGATGAAAAGTTGTTGCCCCAAGAGCGGAAGCATAATTCGATAGAA
        GAGGAGCAGTTTGAAGATGCATTGTTTGAGGAACCACAGAAATGTGTCTCAGATGAAGTGGATGCTAAAAATATTGAGGA
        GATACTAACGGATAGAAGTCAAAACCAGACTCCGAATGGATCTGCTGAAACTACTGATTCAGGAACACCTTCCCAAAACA
        AGCCCTATGTCCATCCACCGATAGACCCATTTTTGCTGGTTCTAAGCGCTTCTGCATCTGCTCCGGATCCCTTTATGCCC
        GAACGGCCGCGTCCAATGTCGCCGCGTGAAATGCGCGAGACTCTGGAGGAGATTAAGCACAGTTTCCGTGCCCAACTGGA
        AGCAGAGCCCTCCGTATCAGCCTCACCATCACCCTCCTTGCGGCCCAAGGCCAACCATGGCAAGGGACGAGCTCCACCAC
        CGCCCTTGCCACCCAAGAAGCACTCATTGAGTCCCCAACCGGACGCCATCAGCCAGACATCGACGGGCAGCGTGGAACGC
        AAGTCAGGTATCGGACAACTGTTCAAGAATATCAAAGCTAATGTGCTGCGTAACAAAGCTAATCCCAGCCAGCAGCAGCC
        CGAGGATGAGCAGCTGGCGGCCAAAGAGACACAGATTTGAAGACAAATCCATGTCTGCTAGCTGCACCACCTTGCCCCGC
        TCGAGCAGCCGGAAATCGGAGAGATCCCAGGGTGGAACTGCCACTGGCCAGATGAAAACGCGCAACAAGTCGGAGAAGTA
        GTGGAGCATCGGTTTAAGGCTGCCCATCTTTGTCAGTATGTTGATTTAGATGGTGACGGTGGGCAGACAGTGGAATCCAT
        AGAACCAGAACCTCATGTTTTAGTTTAAATTGTAACTTTATACGGATATCGATACAGATTATGATAATATTAGCTATATA
        TGCGCATGCACTGTGTACTTTGTTTGTGATTCTATTAGAGCTCCGGGCGCAGTTCGTCCTGGTTGCCACTGGTACTCATT
        TCGTGACTAGTTTAGCGTTAAGCGAGTCTCCTAGCCTCTATCCAAAGGTTCTGCAACAGATGTACTAACCAAAAATGAAA
        CCCGAAGAAACCTATCAATTGTGTAGCATAAATTCCTAATATTGTAATTGAACATTAAATAAAAGAATCTATACCATTGA
        TCCATTGAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0302766
        1573
        FBtr0302767
        1469
        FBtr0302768
        2534
        FBtr0302769
        2715
        FBtr0302770
        2755
        FBtr0302771
        2718
        FBtr0302773
        1243
        FBtr0336697
        1321
        FBtr0344190
        2601
        FBtr0345077
        2641
        FBtr0345078
        1863
        FBtr0345079
        1823
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291912
        408
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0291906
        435
        FBpp0291907
        288
        FBpp0291908
        288
        FBpp0291909
        569
        FBpp0291910
        716
        FBpp0291911
        570
        FBpp0291913
        151
        FBpp0307678
        291
        FBpp0310602
        538
        FBpp0311307
        685
        FBpp0311308
        459
        FBpp0311309
        312
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG42678-RK
        Reep1-RK
        ReepA-RK
        Secondary FlyBase IDs
          References (0)