General Information
Symbol
Dmel\chk-RB
Species
D. melanogaster
Annotation Symbol
CG3409-RB
FlyBase ID
FBtr0302166
Feature type
Associated gene
Evidence Rank
Length (nt)
5152
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCGCTCTTCCGACGAGCTGCGGGTCTGTTGTTCTTCCATCCCAGCCCGAATTGTGCTGGACGCGACGCGACGGAACGG
        GACACGGGGCACGGGACGAGTGGACTTGAGGGCGACGTTGGCGGCTGTCTAGCGCGTTCCTAGTGCGTTTCTTTGTTTTC
        GGCCATTGTTGTGTAAATACGGACTAAGCGAGATGTGGACTTTAGGTTTCGAGCACGATGTGCTCTACAAAGTGAAAGTG
        CTGCTCCAACCGCGAGTGCATTCGAAGAGTGTTGCATGCCACGGGGCGCAGTAGATGTTGCTGAACTAGTTTGGAACGAG
        ATAAACGAAAACCGTTTGCACTGAAGGCTGCTAATTGAGGACGAGGATCATAAATCATTATCTGGCGCCAGCGAGGAGGC
        GAGCACAGCGACAGCAGCGATTGAGTTGCACCACCAGAGACGAATTAATCATACGCCGCGTTGGTCGTCCCTCCGTCGAT
        ACTAAGATATACATATATACAATGCCTGCGAATCCGCCTCCGCACCACGCGCCGCGCACTTGACACGGGGAGCGGCAGAG
        TAGCCGGAGAAGCCAGTGAGGCCCAGTCTTGTGTTCGATTTGTGTTTGTTATTTCTTGTTCGAGCTAGCCGGGCACGCTA
        GTTGGCATCGTTGGCATCGAATCGAAAAGTGTTTGATTTCCGCGAAAACAAAGTACCGCATGTGGCTGCCAGGGCAAAAT
        CTGCTAGCCGGCAGCACAAACTGCAACAACTGCATCTGCAACTGCAACAGCAACAACAGCAACATCACCAGCAACTGCCG
        CCAGTTGCCGTCAATTATCGCTCAATATATTCTCCGTTGGCCTGTGATAAACCCCCTAACGTTCTTAATGAACGACCTTC
        GGTCCAAGTCATTCTATCGTGCAGGCAAACCAACATCTGCAGCATCCGCGTCGGGCGCGACCACCAACGCCAAGTCGTTC
        GACAAGGGCCAGAACAACAATCCCCGTACTTACAACAACAGCGGCAAGTCGAACAAGGTGTTCCTGCATTACATACCCCG
        CGATCCGCGCCTAAGAATTTTCAACAAAACCGCCACCCTGAATAAACACTCGAATCGCACCCTGAGCGAGCTAAACATAA
        CTGAAGATCTGTGCAATTATGGTGAATTGATTGGCGGTGGTGCCGAAACAGTGAAACTAGTGCCAGTGAAATCTTAAGAA
        TATATCCGCAAAATCCGCAGATCACCGAATCAATTTATTCGTTAACAAAAGTTGGCTGTTGGCGTGCGGAGAGAGCATTG
        CCTGGACTACGATCGGCTACGCACTGCAGTTGACCAACAGAGAGAGGGAATATTTACCTACCGCCTACTTAAGAAAATTT
        ATGCTGAAATCTAATGCAAATTGTGTTCACTTCCAATAATCGCTTGGACAAGAAAGTGCAAATTTTACAAACCTTTTTAT
        AGACGTAGCTGAACCCTTTACACAACAACACGATCACTGGGACTCCGACATGGCCAAGCTAGCGACGGATCCAAACGCCT
        CCAACAACAACAGCTGCGAGGCGGTTAACAACAACCACAATGGCCAGAACCAGAGCCAAAACGGAGGCGCCTCCAATTAC
        CAGGCCCTGCCTCTTACGCCTGCTCCGGCCAACACGCCACTCCACAAGGCCATCAAGCACGACCTCTTCCCGGAGGTCAC
        CTTCTGCAACCTCTCCGTAGAGGAGCTCGCAGATGGGGCTGGACACAGCCGTGTGGTAAGGAGCAGTGTCATCGAACTGG
        AGGACGGCACCATGACGTGCCTGATGAACGGAAATGGGCAGGTGAAGCGTCGCAAACGCCTGATCTCGAACGAGTCCGGC
        GACTCGATCGACTCCAGTTCCACGGAGAAGAAAACGCCCAAGATGCCCGACGGTGGATATGGGTGGGTGGTGGTGTTCGC
        CTCTCTGGTCGTGTCCCTTATAGCCGACGGACTGAGCTTCTCATTTGGCCTAATAAACGTGGAACTGCTGGAATACTTCG
        GAGAGTCCACTTCGAAGACCGCCTGGATATCCTCGCTATTCTTCTCCGTGCCCCTGTTGATGGGACCCATCTGGTCCAAT
        CTGGTGGACAAGTACGGCTGCCGAAAGATGACCATCCTCGGCGGAGTGGTCTCTGCCTTTGGGTTTGCTCTGTCTTCGTT
        TTGCAACTCGATCGAGATGCTCATGGTGACCTTTGGTATCATTTCGGGACTGGGCCTAGGCATCGGGTATGTGACCGCGG
        TGGTGTCCATTGCATTCTGGTTTGACAAGAAGCGCACCTTTGCGACCGGCATCGGAGCATCGGGCACCGGCATCGGGACC
        TTTGTCTACGCCCGCCTTACTTCCTATCTAATCGAATCGTACGGCTGGCGCGGAGCCACTCTAATCCTTGGCGGCACCAT
        GCTCAACGCATGCGTTTGCGGCGCCCTCATGCGCGATCCCGACTGGCTGATCGAGGAAAACCGTCTAGAGAGTCGATCCC
        AAAGCGTCACCACCTTCTCGAACTCCAGTGTCTGCCTGGAGGAAATAAAAAAGCTGCTGGACACCGGCATCACAAAGGAG
        GCTGTGCTAGACTCGTTGGTGACCAAGAACAACACGGAGGCCAACCAGCAGATTGACGATCCGTTGGACTCCGCTCTCAA
        GCGCTACCGCAGCGAGATCTTCCTGCCCACCTTCCTGAGCACTCAGGAGCTTGACAGCATCTGCGAGGTTAAGAGCCTGA
        GCCGACGCTCCCTACGCCACAAGGAGGGTGAGGAGGCGCCGTCACGAGAGAACCTGCTGTCCATGTCCTCAGGAGCAGGT
        GCCTATCCCCCATCGACGGCCGTTATAGGCTCGCCAGATGATACCCTAATGGGCGGAATAGCTCACGAGGCGGCAGAGGA
        AGCAAAGAAGGCCTATCTGGCCTCCATCGAGACGCTGTCTCCATCGGAAAAGCGCTCCACTGGTAGGACTCCCAATGGCT
        CGCTCCGCTCCTCGGACGAAGGCTACCTTACGCAGAAGCACGCCAGCTCCCGGTACTCGCTTAACGAAAACATCTTCATG
        GCCAAGCATACAACACCATCAATCTCCAACCTAAAGGTGAATGGCCTGCGACACAATTCGGTGGACATCTTGAGCGAGGA
        CATGCACTGCTACTACTCGAAGGACGAGACCTTCGCATTGCTGGAGCCGAGCAGGCGCATCAGGCCCACCGTCATCGCCA
        TTCCGGAACAGGAGCAGTCGGTGAACAGCGAGCTGGCCACCCGTCGCGCACGCCTGGACAGCATCACGGGAATCCGCCGG
        CTGTCGCGCTCCAAGAAGCCCAGCCACCACCGATCGAACCTCCGCCGCAACATCTCGATCCGGAACTCCAACTTCCTTAA
        GGATATGCGCATTCACCGCAACTCGATCCACTACCGCGGGGCCATGCTGAACACGCACCGCTACCGGCTGCGCGCCTCCT
        CCTGTCCCAACATCTACCGCAACTCGATGACCACCATCGCCAAAGAGGAGGAAGATACCTGGTATGACAACTTTGTGGAC
        ACCATGAAGTCCATCTTTGACTTTTCACTCTTTCTGGACATGAAGTTCGCCCTCTTCAATCTCTCTACATTGTTTTTGTT
        CATTTGGTTCATTATCCCCTATCTGTACCTTCCCGATTACATGAAGCAATACAAGTACGACGTGAGCCAGAGTGCCGAGT
        TGATTTCGGATGTCGGCATTGCCCAAACGGTGGGCATGATAGGACTTGGCTATCTGGGGGATCTGTCCTGGATGAACATC
        AATATATGCTACTCGCTGTGCATGCTGGTGTGCGGAGCGTCTGTGTTCTTCATGCCCCTGCTGATTACCAACTACATGGG
        CCTGATGGTCATGTGCGTTATTTTCGGATTTACGTTCGCCAGCTCCTTCTCGTTTACGCCCAGCATTCTGGTCAGTATTG
        TGGATCTGGACGATTTCACGTGTGCCTACGGTCTGGTGCTGCTGGTTCAGGGAGTTGGAATGATCGCAGGACCCCCTATT
        GCAGGCGTCATATACGAGTATACGGGCAGATGGGATGACACCTTCTATTATGCTGGAATATTTATCGCACTCTCTGGTGT
        CTGTTCGTATCTGATCGAGTTCTGTGAAAAGAAAGCACCTAAGGAGAGTGATAGTGATGTCTTAGAGACTAAAAAAGCTC
        AACTTTTACACTAGGTTACTTACATTGCACTGTTGAACGCCGCAAGTAGAAGGCAACTGGAGGTACTACAAATCCGAACT
        GTAGCATAATAATGGACTAGCATTAAATGTTAACGAGTTTCTTATGTCAAATGGTGTTGCAGCCATAAAATCAGAGCAGA
        ATTGTAACTGAAACTAAGCCTATTCCTAAGCTCTAGCCTGTAAGACTATACTTGACTTGACTAATCGTAGCTAAGTATCA
        ATATACACCTAACATATACTTACCGCACTAGGGCAATTACTAACCGCATCTTTGTCTAGACAAACTGTTCAATTTCAATC
        AATATCAATGCAGTGCATCACTGCCAGGTGCAAACGGGTCCCTCAATTGTCTTCTTTACAAAATTTAGAAAAATAGTTTT
        AATTGCCTTACATTTCGTACGAATATTAATTAAAGGGAATACAATAAACAACAATCTATGTAACGTATGCAATAACAAGT
        GACCATTTTCAATCAATCTAAAACTCACAATAAAATCTTTGGAGCATTTGTTTGTACATCAAACGTCACGGATCCGAATA
        GTTTCCAATTAAAAAAAACCAACTGAGCAAATTAGGGTATAAAAAATAGTTAATGTTGAAGCGAAAAACTTGTTTTTGCA
        GTTTGGCAAACTTTTTCTTAGACAAAACACAGATAAGATTCAGAAAATAAGAAACAAACCTATGTAATATCTTAAAAGTT
        CAAGTATTATTAAAAAAAAATACAAAAATATTTCTAAATAGTATATTTCAGTAGTAAAAAAATGTTTTAACATGTAAGCA
        CATTTAAAAAAATTAAGTAAATGCGACACTATATCCCTATAGCCGACATAGAAAGTGGAAATTGTTAATTCCGAACACTT
        TAGGAAATATGTACATAAACAAAAAAGGATTCACCATTTAATAATATTTACAAGACATTAATTCAACAATTATCTACCGA
        AAGCCTCTTACTAAATAAAAAGGGTTAAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086140
        5083
        FBtr0336659
        4496
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291376
        894
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085473
        894
        FBpp0307642
        894
        Comments
        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).
        Transcript terminates at site supported by polyadenylated cDNA.
        Dicistronic transcript.
        transcript_exception: dicistronic_mRNA
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG3409-RB
        chk-RB
        Secondary FlyBase IDs
          References (0)