General Information
Symbol
Dmel\D1-RD
Species
D. melanogaster
Annotation Symbol
CG9745-RD
FlyBase ID
FBtr0301524
Feature type
Associated gene
Evidence Rank
Length (nt)
1597
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 42 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTTACATCACTACTTTGAACTGTACTAGCGTGCGCGTATTTTACAATTACAAATTGAGAAGGCAAACTTGATTTTCGGCA
      AACAAAAAGAGAAATGGAGGAAGTTGCGGTAAAGAAGCGCGGCCGACCGTCAAAGGCATCCGTCGGTGGTAAATCTTCAA
      CAGCGGCGGTTGCAGCAATCTCGCCAGGCATCAAAAAGCGCGGTCGTCCCGCCAAGAACAAGGGCTCCAGTGGCGGTGGT
      GGACAGCGGGGTCGCCCACCGAAGGCGTCAAAAATCCAAAATGACGAAGATCCCGAAGACGAGGGGGAGGAGGACGGCGA
      TGGCGATGGCTCCGGCGCTGAGCTTGCAAACAACTCATCACCCTCGCCGACGAAGGGCAGGGGACGACCCAAGAGCAGTG
      GTGGCGCCGGATCAGGATCCGGGGATTCGGTGAAGACGCCCGGTTCCGCCAAGAAGCGCAAGGCCGGCAGGCCCAAGAAG
      CACCAGCCCAGCGATAGCGAGAATGAAGACGATCAGGATGAGGACGACGACGGCAACAGCAGCATCGAAGAACGTCGCCC
      AGTGGGCCGACCGTCGGCTGGATCCGTCAACCTGAACATATCGCGCACGGGACGCGGCCTGGGAAGACCCAAGAAGCGGG
      CTGTCGAGTCCAATGGCGATGGGGAGCCACAAGTGCCCAAGAAACGCGGTCGTCCACCACAGAACAAGTCGGGTAGCGGT
      GGCAGTACTGGCTACGTACCCACCGGTCGTCCGCGCGGTCGTCCAAAGGCCAATGCTGCACCCGTCGAGAAGCACGAGGA
      CAATGACGACGATCAGGACGATGAGAACTCCGGGGAGGAGGAACACAGCTCGCCTGAGAAGACGGTAGTGGCGCCGAAGA
      AACGTGGACGTCCCTCTCTTGCCGCTGGCAAGGTGTCCAAAGAGGAAACAACAAAGCCCCGTAGTCGCCCAGCGAAAAAT
      ATTGATGACGATGCAGATGATGCTGATTCCGCCGATCAGGGCCAACACAACTCCAAGAAGGAGTCGAACGACGAGGACCG
      TGCCGTGGATGGGACACCAACCAAAGGAGATGGCCTCAAATGGAACTCCGATGGCGAAAATGATGCCAACGACGGTTATG
      TTTCGGATAACTACAACGATTCCGAATCGGTAGCTGCCTAAAACATACAATTTATAAACATTTCCACACACCCCTCCCCA
      AAAATCAACACAAAAAAAAAAGAATGTTGTAAAAGCAAAAAAAAAAAAACGAAAAAAAATCTGCAAGTAAGAGAAGAAAA
      CACAAAAATGGATAGGACCTACTTGGACTTTAGAGAACCTTCCCCTCCTAAAACAACACACTTTGTCTACATATATATTC
      CGATTTATTGCTGAGAAATCGGACAAACCGTTTACAACTGCACTGCACTGTAATGACGACACATAGCTCGGAAAACGATT
      TCAACTTGGATTGAAATTACCAAATAAATAACACATAAATAACATATTTGGGGAAGATTTCAAGTTCCGAAGTAGAACTG
      AACTTTATTGTAACAACAAATTTGATTTGATTGCAGAAATTTCAATCGTATACAAGTTTAAATAAACCTACTATACC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0081988
      1734
      FBtr0081987
      1811
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290739
      355
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0081468
      355
      FBpp0081467
      355
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      D1-RD
      Secondary FlyBase IDs
        References (0)