General Information
Symbol
Dmel\NFAT-RE
Species
D. melanogaster
Annotation Symbol
CG11172-RE
FlyBase ID
FBtr0301451
Feature type
Associated gene
Evidence Rank
Length (nt)
6009
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 20 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TGGTAGATACAAACAATTAAAGCAACTGCAGAGCAAATTTACCAACAAACAAAGCAACAACACACAAAACAAATGTACAA
      AGTCAATCCAAAATTACAAATATTAATTTAAAACACAAAGAAACAATTAAATGTGCCAACAATATTTACCAAATCAACAA
      AAACAATACAAGTCAGAGGGAAGACAACAAAATCGATGCCTGTAAACATAATTATAAAATATACTAAAAGCACTTATCCC
      AAAAAGAGAACGAGAAACTCGAGGAGAGAGTAGAAAGAGTGGAAAGAACAATCACTAATCGAAAATAAATTAATTGCACC
      ACAAATAGCCATAAGAGTTAATTAAAGTTATTTAAAGAGTCCAGTGAAAATCAATCAAAATGCGATTCACCTACAATCAG
      TATAAACATTATGAGTCCGGTTATCGGATTCCATCTAAAATGCATAATCTGAGCCATAATAACAACAATAATAGTAATAA
      TAATAATAATGGGGGTGGCCACACCAACAACAACAACAATGGCAACAATAGTGGCCATCACTATGCCCATCACAATAATA
      GCAACAATGGCGGCAATAACAACACAAATTTCCAAGCCTATCAGCATCATTACAAAAGTAATTTCGGCATGAGAATGACC
      ATGTCCACCAATTCCACAATGAGTGCGCGTATACATCGAAAAGGATTTCGCATACCATCGAAAAGACAGCCGGGTAAGGG
      ATTGCCCGGCAAGTTGCACACCATAACCAGGACGGGTCCTGGCAAAATGGTTCCTGGGAAGCGAATACCACAGCGACCCC
      ATCCGCCGCCCTGCGACAACTCGAACGACAGTGGGCTGGGTTTCGATCAGCACACGGAGCTGAGATCCTCGGCAGGAGCT
      GGGGGCGTTACTGATCCGGCGGCCAATGGAGGCAGTGGCTCCAACTCTGGCCAGCGATCCAGTTTGCTGGTCAATAGCGC
      TTTAACCAACACAGTGGCTGCTGCAGCAGCCGCAGCAGCTGCCGCGGTGGCCAGCAACACGTTGCAGCAGCATCAGCAGC
      ACCATCAACAGCAGCAGCAGCAACAGCAGCAACAACAGCAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAA
      CATTCACCGCAGCAGCATTTAATCAGAGCGATACCTGTATCAAGATTCATATCGGCCAGGAATGTCACGCGTGTGGCGAA
      CAAACGTCAACCCACTACACCGCTGAACAGCGTCGCCAGCTCCAACGATGGCCAGGTGCAGCTGGAGATTTTGTCGCAGC
      CGGAGCAACAGCACCGGGCACGCTATCAAACGGAGGGCAGCCGCGGTGCCGTCAAGGATCGCAGCGGCAATGGATTCCCG
      ATCGTCCGACTGACCGGATACGATAAGGTTGCCGTCCTCCAGGTCTTCATCGGCACGGACATTGGACGCGTGGCACCGCA
      CATGTTCTATCAGGCCTGCAAGGTTGCCGGCAAGAACTCGACGCAGTGCAACGAGAAGAAGGTCGACGGCACCATGGTCA
      TTGAGATCGATTTCAAGCCCGAAACGGACATGACCATCACATGCGATTGCGTTGGAATCTTGAAGGAACGCAATGTGGAT
      GTGGAGCACCGATTTCCCGAGCATCTGGCGCAAAAGAACAAGAAGAAATCGACTCGCTGCCGGATGGTGTTCCGCACCCA
      GCTGACCCGTGACGATGGCACCACCGAGACCCTCCAGGTCTGCTCGAATCCAATCATCTGCACTCAACCACCTGGCGTGC
      CGGAAATATGCAAGAAATCCTTAAACTCATGTCCCGTTGATGGCGGCCTCGAGCTTTTCATTATCGGCAAGAACTTTCTG
      AAGGACACACACGTGGTGTTTCAGGAGACATACGACAGCGTCAACGGTGACGATCCGGCCACGGAAATTGCAGTGCGCCA
      GCAGCTCATCGGCGGTACAGCCGCTCTTTGGGAACAGAGTGTTCTGCCGGATAAGGAGTACCTTCACCAGACTCATCTGA
      TATGCACGGTGCCACCGTATCTGCACCAGAACATCCTGAAACCGGTCCAGGTTCAAGTGTCGATCGTCTCCAGCGGCAAG
      AAGAGCGAACCGCATACGTTCACCTACACGGCCAAGGGACAGTACACGACGCTGGCGGCGGCCAGCACGTTAAGTAACAC
      AATCCACGCCCAAGCAATTTAGGTGCTCAATCTAACTATATAGTCAAATATGTAAATTTTTGAGTGCTATAAAATGCAAG
      GCCAAAATTAAATCAAAATTAAGTCATTAATCGACAGTCAATATAAACAAGTATATAGACACCGATATATCCTGTATCTC
      TCTATATATACAAACACGAACAGCAACCATAGCAAAGTGGCCAACGAAATAAATCGAAAGCTTGCCTGGAAAGCAACGCT
      GGATAAAAAAGCGATGTAATCGAATGAATCGCAGCAATCGCTCGATAAGTGACTGACAATCGCTTGCGTTCGATGGCGAT
      AGATACTCACACACCCACACACGTCACACAGACACACAGAAATCAAAAAAAAACAAAATATAAATTATTTGAAGGACCTA
      TGGCACCGAGGCAGCAATATCCTATCCAACCGCATGTGAAATGATGATCGGCGACGGATTTTCAGCCCCAACGAGACTTC
      AACAGCCACATCTGCTCATCTCTAGCCCCATCTCTAACGTTCAACAACAACAGCATCAAGGATAATTTTAGGGTACTGGT
      TAAAAAAAAAAAAAACCATTCAACTCTTACAGAAACCAATTACCAAACAATAATTACCGATTGACCAACGTACAAATTCT
      TTTTTGCCATTTCGTAATCCATTTTCTATATGTCTATTAATGAATACACACATACACACACACACACACACACAAAACCC
      TGCCCTTAAAACACACACACACACACACCACATATACCATTACTATTAACTATAAGGGAAACCGATTTCACATATAACCT
      TAGAGCATTACCTTTAAGCGTCTATATATATATATACCATATATTTTACGTACTCACATAAAGCTAACACCATTCAAAGA
      TTTTTTGTCCTGTCCTGTTTGCGAATCCTTGCGATCGTTCAGGAGTTGTCATATGTTAGGGATCAGTTCATTTGGCTAGA
      TTAGCTAAGAAATTGCTTCGATTTTCAACAGGGTACGAAAATTGTTGCTAATTTTATTCATTCAGAATCATTGACATATT
      TTTTAATATTTCGCAATCCTTCATAAATACCGTAATATTTCAATCAATTCATATGAAAATTGCAAGATGTAATTACATCT
      TTATTCTCCTACTTATACAATAATTTCTTATAACTTCTTTTCCAGAAATTTCATAAAATAGAGGTGTGTAAATTATGAAA
      ATGTATGGTAATCTATATAGTGACATTTCTTCCCTATAACATTCATTGCATACCCTTTAAAGATCAGTTTCTGTGCTCTC
      CTGTCTAACCATACAATTCATGATACAGAAATTGCAGTTCTATGTGAAGACTGAACTTCAGTTGAATGGAAATTTTCAAT
      ATGCAGACAGTGTCAGGGTTCAATTAAAAGTTCTTTACTTAAAAATGTCTTAATGAAAAGACATGATTATAACAATAAGA
      AACCATAAGCGGGAACTTGGTCTGAAAGACCCCAAATAAGAGGTGGTAGTGATGGGACTCGTCTAGAATGAGTGGAAATT
      CAAAGCATCGCTCGACTTCAGAGCCTCAACATTACGCCTAGAGAACGACATCAGGTTTAGATCATTGCGATCCCGCTTAG
      GAAACGAGAACTGAGATATTTGGGTTTTCTGGCTCCTAATATACTAATCCATAAACACTTTAAATCTAAGCACTAGTACT
      TAAGTTCAGCAATTAGAAGTAACTATTAAGTCTATTAATTAGAGCAACGAAAAAGCTTGGAGTGTGCTTTGATGTGTTTG
      ATTGAATGAATGATTGAGTGTATAAACTTTACGATTGGTGAATGACTGTTTGTTTGATTTGTGCGATTGCCGATTGAGTA
      ATTAGTTGAATGGTTTATGTAGTTTCGTAAAGTGTGATCCTTTGCGATTATTTGTTAAACAAATCTTGTCTTTAGCTGTG
      TGCTTGATGAAGACTTAAGGCTTACTTAGAGGAGTCTGTCTGATCCATTTTCGGGTCGGGTTCGTCTTGTCATTTGTAGT
      GTTCAATGATTGCCTTTTATTATCGATCTGTTCAGCTTGGTGTGGTTTGATTTAGTCAGTCAGTCAGTCAGTTCTTTCAT
      TTTGTGTTCAGTTGAAAGATGAAATGTTCTAAGAATTCTTTGATGACCTCTTTCGTAGCTATCTTGTTGTTCCATTCCCT
      TTTGTAATTGCCGTGTGAAAGGAGTTGCCAGTGAAATTTCGTAGCCAAGCTTAAATACTCTTAAGAACCTAATATATATA
      TAAAATAAATCTAGTCTTAATTAGTGGTTAAGTATTAGAATTAGATACCAACGTCCCTGCGGAGATGGCAGATCCAAAGA
      ATTCGAGTGCTTTTCTATTGCTATCGCTATAGTTTAAGTTTTTTTTTAGTTTGTAAGTTGTAGTAGACCCGGAATAAAGT
      GAAAGGCACTCGGATTTTACGGACCTCTCCCTTAGCAATCCCCTTCCAAGACTTATTCTCAGAAACCTGACCTAGGATTA
      AGAGGACCCCAACCCACCAAAACAAAAAGAAAATACCCTGCCGTTTATTATATCTTTGTTTTTTCTTTTATGATTTCTTA
      TATTATGACCCCGTGATTCTTGCATGACATACCACCAAAATGAGATTACTAAGATGACTCTTTTCTGTCCATTGTTCCTC
      TTGTAGATGTGAGCGGTTTCATGGACACCACATCAGCGTCCAATGCGAGTGGCTCCAGTGGTTGGAGTGCGGCAGGCGGT
      TCCGGCAACAATACATCTACAGGCGATAATGTGGAGGCCAAACACGAGATCGATTCGGGCATGATGCCTCCGCCCATTAC
      CACCCAAATACCGATGGGCGTTCGACGCTCCTCGCTGCCCAGTGTCACACCCATGATCACGGACCAACAGCTGGTCCATC
      TCAACGCAGTGGCGGCCAGTGCCGAGGCCCTGAAGACGGAACTCGACGACAGCAACTCGCATAGCCCACTGACCGGTGAA
      TCCACACCGGATAGCCCCAACGCAGCCTTGCAGTATCATCGCTTTGCACGAAAGCCCAGCCTGGACACCATTATGTACGA
      TCAGTCGAACAGTCTGCCCGGTTTCCCGACCGTTGTGGCGCCGGCTACAGCTGCCGCCGTGGCCGCTGCAGTTGATATTG
      ATCCGACGGCGGTGGCCGTGGCGGTGGAACTGGCCGTAAAAAATGAGATTGTCAAGCATGTCGTACAGCAGCACCAGCAG
      ATGCAGGAGCAAATGCACGAGCAGCAGCAGCAGCAACAGCAGCAGCAACAACAACAACAACAGCAGCAACAACAACAACC
      CCAACAGCAGCAGCAGCAACAGGTGCACAAGTTTATTGACGAGCTGACCAAATCCACATCGGTGGTTTCCAGCAATGGTA
      CCACCGAACCAGCTCTGTTCACCACCTCGGCGGTGATCGATCATGCCCTGACCGATATTCTGCAGGCCAAAGTTGGCATT
      GCGCCGCCCAATGTGGTGCTGGAAAGGAGTTTGTCCCTAAGCTCCACAAATTCCAGCAGCTCCATGAGCGGCAGTGAGAG
      TTCGCCGAATAGTTCACCTTTGACGCAGGATATCATACTCAATTCAGAACCGGCAGCAGCTCTGGCCGGAGCTGCTGCCT
      TGGGTGGCCCGGCGCCTGTCGATGTCACCGGTGGTCTGTCCACCGATATCATTATGAATCCCGCCGTTTCACCATCGACT
      ATTTTGTGCTCCGCAAATGGAGCGGCCACTGCCGTAGTGCCGAATATACTCGCACCTCACCAAGTGACCATGGCCAACTC
      CATTTTGAACGATATTGCCATGCAGCCGGAACCAACACAGCAGGATGCAGCAGTAGCAGCCTTGGCGTTGAGCAACATCA
      TGATGAGTC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0073808
      5870
      FBtr0112980
      5651
      FBtr0301449
      5935
      FBtr0301450
      5243
      FBtr0340396
      5781
      FBtr0345127
      5049
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290666
      600
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0073639
      1419
      FBpp0111893
      1457
      FBpp0290664
      1248
      FBpp0290665
      1210
      FBpp0309342
      562
      FBpp0311348
      1248
      Comments
      Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.
      Extended 3' UTR based on RNA-Seq and/or EST data.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      NFAT-RE
      Secondary FlyBase IDs
        References (0)