General Information
Symbol
Dmel\CG13124-RG
Species
D. melanogaster
Annotation Symbol
CG13124-RG
FlyBase ID
FBtr0300868
Feature type
Associated gene
Evidence Rank
Length (nt)
3137
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCTTCAACTGATCGCTCGCGCCGATGATTTAATTTTTAAGTTAAAGCCTGCGCCCAGTGTAGCAGCCGGCAGCGTTAC
        TCACATCCATATACATACATACGTGCGAATATACATACATGCTCACATAATACGGCGTACATCGATAAATAGATATACCC
        CGCAGATATAGTGTCTCGATCGACAGCAACGAACCCATGGAAACCTAAAGTAAAACCAAAATTCCAAGGTTCCATTGTCC
        CGTAGTTAAATGTGTTTAAATCCAATTACATCCCCGATCCTTTATATTTTGCTCTTACGAATCGGGATTATGTGATTCAT
        GCATAACGAGCGATCTGCATTAAATGAGAGAAAAATCACAATAAAAAGAAAAACGAACGAACACAACAACGCGAACAAAA
        ATTAAGAAACCAAAACGGAATCGGTAATAATTGACGACGAGCAGACAACGAGCCGAGAACAAGCAGCACAAAGCGACAAA
        CCAAAAATAGACGATACCAACGCCACCAGTCATCCGAGCAAAAGCAACAACAATAGGCACTAAAATCAATTGTGATCACA
        GTGCGTTTGTGTGAGTGCGTATGCGTATGCGTATCTGTGCCTTTTTTTGCATTTGCCGCTGTATCTGCCTGCATCTGTAT
        CTGTGTCTAGAGGCCCGCAATCCATAACCATCTAGTGTATTACCCCATATGCGGACTATTTGGGCGTGGAGGGACGCTTC
        GAAATATTAATTATTTCTGACACTGTTTACGGCTTGACTTGGCGCATGCCAAGCATGATTAAACGAGACACGAAAGAGCG
        TATCTACGAAGTAGATAAATATCTTTATACGAACAACTAAGCTGCGGCACCAAGCAACAATCGAATCGACGAATAGCAAC
        AACGCACAAACAAACCCATCTATATATACACTATAGACAGAGATAAACAAAAGCTCAAGCAGCAACAGCAGCAGCAACAA
        CGAAACAATTTGAAGGAAATATTTTTGCACTAAAAGACCCGGCAATCTGAATCTGCAAAAGGGGAAGATATCCCTCAACA
        TCGTATTAAGAAGAGAACTCAACTCGATAAAGGAGGAAAGGAAACCAACTATTGTGATATGTACAAATTTACTCAAATAC
        TGAAGCCACACATTTAGACGTTTATTCGACGGAATCCCAGTTGTGAATCGATTAACCGGAGGATAATCTACCAAAGATTA
        GGCTTTCATCTTCAATTAGGTTTTACCCAAATAGAGCAGAAGCAGTACTCGCGCAAAAATCGCAGGATGGCCGAAAAGGT
        GGAACTACTGGCCCAGGCCAGCATGAATGGCCAACAGAATGATACGCGGAAGGTGCGCAAATCACCGGAATTTCAGCCCG
        GCGTTATCTCCCGCGAACGCAGCTTTGTGCGCACCTCAAATCAACAGAATATCAACAAACGGCGAAGTCTGGCTTTCAAC
        GTACCTGGCAATCAGACGGGACAGATGAGGGGCAAACCAGCCATGGATATCTACAGGCCTCCCAATGTGCGCGGAGAGCT
        AGCCGCTCCAGCCGGTGGTGTCGGTGGTGATGGTCCGAATGGTGCTATCGGTGGTGTCGCCAACAAGCTGAACGTCAATG
        CCCAGGAGTTCACAATGACAACCAGCTCCGGGGCACCGGCCGAGGCACTCGGCAACCGTTCGTCGCTAATACTTCCGCTC
        ACCAATGGACCCGGAGTGGGAGTTGCACCGGGTTTGGGTCCGTACGGAAACGTGAATCGCCGCCAGGCCGGACACTCCCT
        CGGCAACATGCCGGGCTTGAAGGCCAACCACCGGTCGATCCTGGTGACGTATCCAATCAATACCGGTGCCCTCAGCGGTC
        AGCTGCCGCTAATGAACTCGCCATCCAGTGGAAATATACTTCACACAACAAATCGTGTAAAGTTTGCACCTGAGCCCCGA
        GGTCACAAAGTGGCTTCGCATAATCAGTTTGGTCAACTAAACAACAACTATGCTCAGCCTTATCAGGCGAATATTAATGG
        AGTAGATCCTTACATGAATGGAAATGCACTGCAACGCTCCAAGTCGTTGTCGTCGGCGGATGCCCTTACTCGTGGAATGG
        CCGGATTGGGACTAGGTTTGGGCAACGAGGTGGCCGACATAGGACAGTTCACGCCAGAGATCCAGGCGCTTATTGACACG
        GCCCTGGAGGATCCCAATAAACTGAACTCTCGCTGTCTCATGGAACTGACATCGCAGTTCATCAAACGCGCGGTGGAGAG
        TCGCCGTTTTGCTCTGCCAATATCACGACTGTGTCTGAACATCATTGCCCGGGAGCAGAAGGAAACGTTTCTCGAGGCGC
        TCCTCAACACATGCCGTCAGTGGTACCAGGAGCGTGAGAAGCTGTTGTTTGCCATCCAGGGCATGAAGTCGCCATCACGT
        GTCCGATTCACTGCCTTTATGGCCTTCCTTACGGAAATGTTTTGTCAGCTGAAACGTCGGCAGCTCCAGCTACGCACCCA
        CCACGAGGGCACTCCTCCGCCACTGGTACTGCTTAGTCTGCTCTCCAAATGTTGCGGGGATTGCGTGCGTCCACCCATTA
        GATCACTTTCAGAGATTGAGTGCTTGTTTTATGTTTTGACCTGTATTGGCCAGGACATGGAGCAGCAGTTGCCCCAGCAA
        CTGGAGTTACTCATGAGTCTGGTTCGCGATGCCTTTTTGAATGCCGGCGAATCTGCGGCCTCCATTCGGCGCACTCTTCT
        CCAACTCATCGAGCTGAAGGCCTCCCACTGGCAGCTACCAGGCAATACGGTTCTTTACTACACGCACACTAACAATTAGG
        AACGAGATCTGGAGCTGGGGACATGGCGGGGATAAGGGCACTGTGCAAGCATCAGGACACCATGAGCAATTGATTCTGTT
        GTCGCATTGCATTTAGGGCCTGGAAAACTTCTGTTCTATTTATCTTATTGTATTCTTACCTAGACATAAGCAATATTTAT
        TTCGGCAGCAGCTATAGAGAGAAACTAACCCGAGACTTGCACACTACACACCAAGCACAGTACCAAATAAGATCGAACTC
        TTGGATTCGATATCTTTGGACTGTGCTATAATCTAAGGCTCAACATTTATGTGAATCCATATATTTATGTGTAATAAATC
        ACAGCTAGTCAAACGAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0079902
        3023
        FBtr0079903
        3095
        FBtr0290197
        2893
        FBtr0300866
        2913
        FBtr0300867
        2977
        FBtr0300869
        3084
        FBtr0300870
        2854
        FBtr0300871
        3114
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290090
        510
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0079497
        510
        FBpp0079498
        510
        FBpp0288636
        469
        FBpp0290088
        510
        FBpp0290089
        510
        FBpp0290091
        510
        FBpp0290092
        469
        FBpp0290093
        469
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG13124-RG
        Secondary FlyBase IDs
          References (0)