General Information
Symbol
Dmel\PMCA-RI
Species
D. melanogaster
Annotation Symbol
CG42314-RI
FlyBase ID
FBtr0300554
Feature type
Associated gene
Evidence Rank
Length (nt)
4135
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 83 )
Sequence
ACTGCTGAAAAGGAAGGCGTCACAGTGTCAGTACTTTATATTAAATATTTCGCTATATATTGTGGCGTTTAACTTGAGTC
GTGTACAATTATTTCGCCTTCTAGTTGTATAAGACCATAACAAATGGCCACTATAGATGGAAGACCGGCGCAATATGGAA
TTTCACTTAAACAACTGCGCGAGCTCATGGAGCATCGTGGTCGTGAGGGTGTAATGAAGATAGCTGAAAATGGTGGCATT
CACGAACTATGTAAAAAGTTATACACATCTCCCAATGAAGGCCTAAGTGGATCGAAAGCTGACGAAGAGCATAGACGTGA
AACATTCGGTTCCAATGTTATACCACCGAAGCCACCAAAGACCTTTTTGACTCTAGTCTGGGAGGCTCTTCAAGATGTGA
CCCTTATTATATTAGAGGTAGCTGCATTAGTATCGCTTGGTCTATCATTTTATAAACCCGCCGACGAGGATGCGCCTGTG
TTGCAGGAGGAGGAAGAACACCATGGTTGGATTGAAGGATTGGCCATTCTTATTTCTGTTATTGTCGTAGTTATAGTGAC
AGCATTTAATGATTACTCTAAAGAAAGACAATTTCGAGGTCTGCAAAATCGTATAGAGGGCGAGCACAAGTTTTCAGTTA
TTCGAGGAGGAGAGGTGTGCCAAATATCAGTTGGTGATATTCTTGTTGGCGATATTGCTCAAGTTAAATATGGAGACTTA
TTGCCGGCTGATGGGTGTCTTATTCAAAGTAACGACTTAAAGGTGGACGAATCTTCTCTGACTGGAGAGTCTGATCACGT
CAAAAAGGGGCCAGATGTTGATCCCATGGTTTTATCCGGCACGCATGTTATGGAAGGAAGCGGCAAAATGGTTGTTACAG
CCGTAGGGGTAAACTCACAAGCTGGTATAATTTTTACGCTCCTTGGTGCGGCAGTTGACGAACAAGAAGCAGAAATTAAG
AAGATGAAAAAGGAAGCGAAAAGGGCCAACAAGCAAAAGAATCTGACAGGTGAAAACGATGGTCGATCGCAAATAAAGGG
GTCCCAAGCGCCATCTCAACGCGAAACAGTCACGAGTGAGATAACCAAATCTGAGTCTGAAGGAAATCATTTGCCGCAAT
CATCGTCATCAGGAGCGGCTGAAACAGGACATAAAAAAGAAAAATCTGTGCTTCAAGCTAAACTAACAAAATTAGCTATA
CAGATTGGATATGCTGGGTCGACCATTGCCGTACTTACAGTTATAATTCTGATCATTCAGTTTTGTATTAAAACGTTCGT
TATTGACGAGAAGCCATGGAAAAACACGTATGCCAATAACTTGGTGAAGCATTTGATAATTGGTGTTACAGTATTAGTAG
TGGCCGTACCTGAGGGGCTTCCATTGGCAGTAACCCTATCCCTAGCATACTCAGTCAAGAAAATGATGAAGGACAATAAT
TTGGTTCGTCATTTGGATGCATGTGAAACCATGGGTAATGCCACTGCCATATGCTCTGATAAGACTGGCACACTTACGAC
CAATCGTATGACTGTTGTACAATCCTACATATGTGAAAAATTGTGCAAGGTTTTACCAACCCTTAGCGATATACCACAAC
ATGTTGGAAATTTAATTACAATGGGAATATCTGTTAACTCGGCTTACACCTCAAATATAATGGCTGGACACAACCCAGGA
GACTTACCAATTCAAGTTGGCAATAAAACGGAGTGTGCTCTTTTGGGATTTGTCCAAGGGTTAGGTGTGAAGTATCAATC
TATTCGAGATGAAATTACAGAGGATAAATTTACACGCGTATATACATTTAATTCAGTTCGCAAGAGCATGGGTACTGTGA
TACCCCGTCCTAACGGAGGATATCGACTGTATACTAAAGGAGCTTCTGAAATTATTATGAAAAAGTGTGCTTTTATCTAT
GGACATGAGGGCACTTTGGAGAAGTTTACGAGAGATATGCAAGAGCGTTTAATACGTGAAGTTATTGAACCAATGGCATG
TGACGGTTTGCGGACTATATCTGTAGCATATCGCGATTTTGTGCCTGGTAAAGCCGCAATTAACGAAGTGCATATCGATG
GGGAACCTAACTGGGATGATGAGGAAAACATTATGACAAATCTTACATGCCTCTGTGTGGTTGGTATAGAAGATCCTGTT
CGTCCCGAAGTACCAGACGCAATTCGAAAATGTCAACGCGCTGGTATAACTGTTCGGATGGTCACCGGAGACAATATTAA
TACAGCACGCTCAATTGCCAGCAAATGCGGCATTTTGCGTCCCAATGATGACTTTCTTATTCTGGAAGGCAAAGAATTTA
ATAGGCGTATTCGTGATAGCAATGGAGATATTCAACAACACCTTATCGATAAAGTATGGCCAAAACTGCGGGTTTTAGCA
CGCTCATCTCCAACTGACAAGTATACTTTAGTAAAAGGTATCATTGACAGCACCGTAAGTGAAAACCGAGAAGTTGTTGC
TGTAACTGGAGACGGCACAAATGATGGTCCAGCTTTAAAAAAAGCCGATGTAGGATTTGCTATGGGTATAGCCGGAACAG
ATGTTGCCAAAGAAGCTTCCGATATAATATTAACTGACGATAATTTTAGCAGCATTGTTAAAGCTGTAATGTGGGGACGC
AACGTATATGACTCTATTGCTAAGTTTTTACAGTTTCAGTTAACAGTAAATGTAGTCGCTGTAATTGTTGCATTTATTGG
TGCGTGTGCTGTGCAAGATTCACCGCTTAAAGCAGTGCAAATGTTGTGGGTGAACTTAATAATGGATACATTGGCATCAC
TTGCATTAGCAACTGAGTTTCCTACACCAGATCTATTGCTCCGCAAACCCTATGGCCGTACAAAACCTTTAATTTCCCGC
ACAATGATGAAGAACATATTGGGTCAGGCGCTGTATCAGTTAATAATAATATTCGGATTGTTATTTGTCGGCGATGTTAT
ACTCGATATTGAATCTGGACGTGGACAAGAACTAAACGCGGGACCAACACAGCACTTTACTATTATCTTTAATACTTTTG
TCATGATGACTTTGTTTAATGAAATAAACGCTAGAAAAATCCATGGGCAGCGCAATGTCATTGAAGGCCTACTTACAAAT
CCCATATTTTACACCATATGGATATTCACTATGATATCACAGGTGCTAATCATCCAATATGGTAAAATGGCTTTCTCGAC
GAAGGCTTTAACATTGGATCAGTGGCTATGGTGTATATTTTTTGGAATTGGTACACTTGTCTGGGGACAACTGATTACCT
CAGTACCTACAAGAAAATTACCTAAGATATTATCGTGGGGTCGCGGACATCCCGAGGAGTACACAGATGGTATGAATCTG
GGTGAGGAACGCTTTGATTCAATTGATTCTGATAAAAAGCCTAGGGCTGGTCAAATTCTATGGATTCGTGGTCTAACTCG
CTTGCAAACACAAGTAATAGGCGGCGAATTGCAAGAACGCTTGATTCCGGTCCCATATAGCAAGAGCAACACTGATCAAG
CTATACGAGTGGTAAACGCATTCCGCCAGGGTCTGGACGCCCGTTACGGTGATCACACCAACACATCCCTGGCAGAGGTA
CTGCGTAAGCAGACTTCGTTGAGCAAACGCCTTTCGGAAACGTCTTCCATTGAGTATGCCGATAATATACCTGATGAGCT
GACCATACCCGAAATTGATGTCGAACGTCTATCATCCCACAGTCACACTGAAACTGCAGTTTAAATTTCAGTGGCATCCA
TATCCATATAAAAATAAACCGCACACATTCTCAGAAATAACAATTCTAAGAAATCCTTAGCACAGCTTGGAATTTTTATA
AAAAAAGGTTTTGTTCAGGATAACAGCAATGTAGCTGTGAATTGGTTAAAAAGCATTTTGTAATTCAGCAAAAATAATCC
GTAAAAAAAATGTAAATTTCTAATTTTTTTTGTTAGTATGTATGCTAACAAAATATATAAAGTACTTAATATTAATATAA
TTGTAATGCAAGGGCATACATACATTGATTATAACCACCTTTAACTCAAAATGTAAGCGGATCGGTTTTGTCTCGCACAC
TGAAGCCATTAATTAATATTTTATCGTCTTACATGTAATAAATGATTCAATGAAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0300555
4740
FBtr0300556
4066
FBtr0300557
4053
FBtr0300558
4600
FBtr0300559
3857
FBtr0304046
4101
FBtr0304047
4017
FBtr0304048
4701
FBtr0304049
4065
FBtr0304050
5939
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289781
1206
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0289782
1255
FBpp0289783
1183
FBpp0289784
1206
FBpp0289785
1255
FBpp0289786
1120
FBpp0293009
1206
FBpp0293010
1194
FBpp0293011
1187
FBpp0293012
1210
FBpp0293013
1255
Comments
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG42314-RI
PMCA-RI
Secondary FlyBase IDs
    References (0)