General Information
Symbol
Dmel\Mkk4-RB
Species
D. melanogaster
Annotation Symbol
CG9738-RB
FlyBase ID
FBtr0300443
Feature type
Associated gene
Evidence Rank
Length (nt)
2525
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 114 )
Sequence
TCAATGTTTCATCTCTAGCTCTTTTAAGTTTTGGTTGCTATTTATGTAAATGTTTAGCGAAATTGCGGAAAAAGTGCATA
TCAGTGCGCTCGATTGCTGAAAAAGTAGTTGCGTTGCAAACGGCGAAGAGCCCATCAAAGGCGGCCCAGTAACCAGGCGA
TCGGAGGGCCAAAGGAGCATCAAGTCGACGTGTTGTATTCGGGGCGCGGCGCCTGCAGAAAACGGACAAAACATCCTTAG
GACAGCCACACAAAGGCGCATCGATACTTTCAGCCACCACACACAATGGCCGAACGACCGAAAAATTTGTTTGCAACCGG
ATCCAGTCGCTCCCGCAATCCCCCGGATCAGCTAAGCCTGAATAATCTTAGCATACGCCATCCGCCCTCGTCCACGTCGT
CCACTTCTTCGGGATCCACCTCCTCGGGCTCAAGTTCCTCATCACAGCACAACCATGTGACCCGCTGTTTTGGTGCCCAG
CAGCCACAGCAAACCCCGCCGGTGGCCAGCAGTCAAGTGCCACCGGTGCCGGCAGCATCGAGCAGCAGCGCTGCCGATCG
TCACCGGGAGCGAATTCGCCAGCAGGCCTGTGGCAAGCTACAGTTTGGTGAGGGCGGCGCTAATACACACACATTTACTT
CAGACGATCTCGAGGATGAGGGCGAAATTGGACGCGGTGCATTTGGGGCAGTCAACAAGATGACCTTTAAGAAATTGGAC
AAGGTGATGGCCGTCAAGCGCATTCGATCCACCGTAGACGAGAAGGAACAGAAGCAGCTGCTCATGGATCTCGAGGTGGT
CATGAAGTCCAACGAGTGCATTTACATTGTTCAGTTCTATGGGGCGCTTTTCAAGGAGGGTGACTGCTGGATTTGTATGG
AGCTGATGGACACCTCTTTGGACAAGTTTTACAAGTACATCTACGAAAAGCAGCAGCGCCACATTCCAGAGTCTATACTG
GCTAAGATAACAGTGGCCACGGTCAATGCGCTGAACTATTTGAAGGAGGAGCTAAAGATTATCCATCGGGATGTGAAACC
GAGCAACATTCTGTTGCACCGTCGCGGAGACATAAAGCTGTGCGATTTTGGTATTTCGGGTCAGCTGGTCGACTCTATTG
CCAAGACCAAGGATGCGGGCTGCAGGCCCTACATGGCGCCGGAGCGCATTGATCCAGAACGTGCCAAGGGCTACGATGTA
CGAAGCGATGTTTGGTCATTGGGCATCACATTAATGGAGGTGGCGACTGGTAATTTCCCCTATCGTAAATGGGACTCTGT
TTTCGAGCAGTTGTGCCAGGTTGTGCAAGGCGAACCGCCGCGACTTTTGACATCCTATAACGGCATGGAGTTTTCCAAAG
AGTTTGTGGACTTTGTCAATACTTGCCTAATTAAAAAGGAGAGCGATCGACCCAAGTATAGCCGTCTGCTGGAGATGCCC
TTCATACGTCGTGGCGAGACGAGCCACACTGATGTTGCCGTGTATGTGGCTGATATACTGGAGTCGATGGAGAAAGACGG
CATTACGCAGTTTACGGCCAATCAGCAGGCGGAGAGTTAATCACCCTAAGCGAAGATGCAAGTCATAAATTAACTAAGAT
TCAAGAAGAACACAACAGCATGCATAACTAAGCAGAAGGAAAGCAGATAAAAAGTTTTAATTGTTGTCTACTTTGTAGCA
TTCGTAGAAAACCTAGCGCATATTTTGTTAAACAGAAAAACAAACCTAAGCGAAAAGTGTGTAAGCTGATAGTAAGCAAA
ATGTGTGTGTATAGTTTAAAGTCCCTAAAGCCTATTATAATTCAATAACTTTTGTATTCGCAGTTTTGTGCGTTAAGTTT
TGTGTTGAAAATAAATTTGTGTTTACAACAGGCGAGCGGCGGGTTACAGGCGAATATATGGGCCAATAACTGACCAGCTT
CGGACTCCCAGCCAAAAGCCTATTTAGCCTCAATCAAGCGAACATTTTATAATCCGGTTGATTTATCTATCATAAATAAT
GATAGCAGACTAATTGGAAATGCATTTTGCGTTAATAAGCAACCACATGCGAAACTTAAGCAATATTTGTAAAAAAAAAA
CAGCTTCGTGAAAACGAGAGTTGCTAGCCATGCAAACAACTAACAGAAACACCAATGCGCGTTAAGCGTAAGTAACAAGT
TCAACAAAAACAATTTTACATTATTTATTGAACAGAATTTGTAATCCTATTATATTTTTTTAATTTGCATAATGAAAATG
ATTGTGAAAAGCTTTAAATAATTGCCAAGCGGCTGAGATGTTTAAATGTAGTAGAAATTATTGCAGATAAATGCAAACTA
ATCCCATAATATATAAAAAAAATTAACCATAACACCTACACATTCACAACACACACACACGTTTTTATGCGTAGAAATTA
GTTGTAAGCGAAGCGAAAATATTTAGCAAAAAGTTACAGCTACAAAAACAAAAGTCATGTGAAAACTACAAATAAAACAA
AATAAATGTATTGTGCCTAAGTATAAACCGAAATGATAAACACTC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0081892
2698
FBtr0334320
4110
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289672
424
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0081378
424
FBpp0306434
424
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Mkk4-RB
Secondary FlyBase IDs
    References (0)