General Information
Symbol
Dmel\heph-RQ
Species
D. melanogaster
Annotation Symbol
CG31000-RQ
FlyBase ID
FBtr0300265
Feature type
Associated gene
Evidence Rank
Length (nt)
2391
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 47 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AAGAAACAGACAAAAGTGGTGAATTGTTGCTATAAATGGAATAGAATTTCAGTCGAAAATACCAAAAATAAAGAAAATCA
      AAAATCCGATACTTCAAACGCGCCAAAAAGAAAAAAACTCTCAAGTAACAACCAAGTGCTAAAATTAGAAGCGGAGAAAT
      TTAATCAACATTTGTTGCCAATAAAACTGTCATCATTGCTGCGTTAACAGAAAACACGGCGTCAGCAGCGATTGCAGCGC
      TCAGTATCAGCAGCAGCTCTCAAGCGTCGCTTGCCGCCAACGCCCCCGCCACACCCACACCGCCGCCCACTTCGTCAGTG
      GCAGGAGCTGCAGCTACGGTAAAGAACGAGATCGTTGCATCTGATTCGGCCGAATCCTCCCCTATACAAGATTTAATAAT
      GCCAAGGCCTCAAAAGTCATCCACTTGCGCAACATTCCGAACGAGTCCGGCGAGGCAGATGTGATTGCCCTGGGCATTCC
      GTTTGGACGTGTGACCAACGTGCTGGTGCTCAAGGGCAAGAACCAGGCTTTCATCGAGATGGCCGACGAGATCTCCGCAA
      CGTCAATGGTGTCCTGTTACACAGTAACTCCGCCCCAGATGCGCGGCCGCATGGTCTACGTGCAGTTTTCTAATCATCGC
      GAACTAAAGACGGACCAAGGTCACAACAACTCGACCGCCCATAGCGACTACAGCGTCCAGTCCCCGGCGAGCGGATCGCC
      TCTGCCCCTTAGCGCCGCTGCCAACGCGACCAGCAACAATGCAAACAGCTCAAGCGACAGCAACAGCGCCATGGGAATCT
      TACAAAACACAAGCGCCGTCAATGCGGGCGGCAACACCAACGCTGCCGGGGGACCCAATACTGTGCTCCGTGTGATTGTC
      GAGTCCTTGATGTACCCCGTCTCGCTGGACATACTGCACCAGATCTTCCAGCGCTACGGCAAGGTGCTGAAGATTGTCAC
      CTTCACAAAGAACAATTCATTCCAGGCCCTCATCCAATATCCGGACGCCAATTCCGCCCAGCACGCCAAGTCGCTCCTGG
      ACGGGCAGAATATATACAACGGTTGCTGCACGTTGCGTATTGATAACAGCAAGCTGACGGCTCTGAATGTTAAGTACAAC
      AACGACAAATCGCGCGACTTCACTAACCCCGCTCTGCCACCTGGTGAACCGGGAGTGGATATCATGCCCACCGCCGGCGG
      ACTGATGAACACCAATGATTTGCTTTTGATCGCCGCCCGTCAGCGACCTTCTCTCTCAGGTGATAAAATAGTCAACGGCC
      TGGGCGCCCCCGGAGTCCTGCCGCCCTTTGCCTTGGGCCTGGGCACTCCACTGACCGGTGGATACAACAACGCACTGCCC
      AACTTAGCAGCTTTCTCGCTGGCCAACAGTGGCGCCCTGCAGACGACCGCTCCTGCAATGCGAGGTTACTCGAATGTCTT
      GCTTGTCTCGAATTTAAATGAGGAGATGGTCACGCCTGATGCTCTCTTTACCCTTTTTGGTGTATACGGCGATGTGCAAC
      GTGTAAAGATTCTGTACAACAAGAAGGACTCGGCACTCATACAAATGGCGGAGCCCCAGCAAGCTTATTTGGCCATGTCT
      CACCTTGATAAATTACGTTTATGGGGAAAGCCGATACGTGTGATGGCAAGCAAACACCAGGCCGTCCAGCTGCCCAAGGA
      GGGACAGCCGGACGCAGGACTCACACGTGACTACTCGCAAAATCCGTTGCACCGCTTCAAGAAACCGGGAAGCAAGAACT
      ACCAGAACATCTATCCGCCGTCGGCGACACTACATTTAAGCAACATTCCCTCATCCTGCTCTGAGGATGACATCAAAGAA
      GCTTTCACCTCAAACAGCTTTGAAGTTAAGGCATTCAAATTTTTCCCGAAGGACCGTAAAATGGCACTGCTTCAACTGTT
      GTCCGTGGAGGAGGCTGTCCTAGCACTGATTAAGATGCACAACCACCAGCTGTCCGAGTCGAATCACCTGCGTGTAAGCT
      TCTCGAAGTCGAACATCTAGAATCCGATGCGAAGTCAGGTTTACTGAACCTGACTAGGTACCTCCGGCGGGTACAGCTAC
      ATACAGATGCATCAGCAGCAACACCTTCAGATCCATTGGCAGCAACAAATACAAACTATAATCCGTAGTACAAGAAAAAT
      GCACGCAAACTTCTACTGAAATGGCAGACTCCAGAAGCACTACCCACCCAATCCAACATAATAATCAGCAGAAACAATCG
      ATGCAAGAGCTATACCAATTTTAAACAATTCAACTCACTCTAAGAACTGTTTTCTGTTCATACACTACCCCTTAGTGGGA
      AAGACACAAACAATTAAGGAATCTTACTGAATTGATAAAGAAAAAACTACAAATAAATATACATGAAAATT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085879
      3333
      FBtr0085878
      2405
      FBtr0085880
      2979
      FBtr0085882
      2915
      FBtr0085883
      3821
      FBtr0085888
      3427
      FBtr0085887
      2986
      FBtr0085881
      3496
      FBtr0085884
      3026
      FBtr0085885
      3084
      FBtr0085886
      2846
      FBtr0112864
      3839
      FBtr0112865
      3424
      FBtr0112866
      7366
      FBtr0300263
      3496
      FBtr0300264
      2592
      FBtr0300266
      3496
      FBtr0300267
      3715
      FBtr0300268
      3157
      FBtr0300269
      7770
      FBtr0300270
      3128
      FBtr0306692
      3651
      FBtr0306693
      3869
      FBtr0346192
      3483
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0289493
      493
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0085238
      608
      FBpp0085237
      608
      FBpp0085239
      581
      FBpp0085241
      608
      FBpp0085242
      608
      FBpp0085247
      608
      FBpp0085246
      615
      FBpp0085240
      789
      FBpp0085243
      608
      FBpp0085244
      608
      FBpp0085245
      608
      FBpp0111777
      622
      FBpp0111778
      568
      FBpp0111779
      608
      FBpp0289491
      789
      FBpp0289492
      608
      FBpp0289494
      789
      FBpp0289495
      581
      FBpp0289496
      581
      FBpp0289497
      581
      FBpp0289498
      608
      FBpp0297631
      799
      FBpp0297632
      898
      FBpp0312011
      604
      Comments
      Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      heph-RQ
      Secondary FlyBase IDs
        References (0)