General Information
Symbol
Dmel\fkh-RB
Species
D. melanogaster
Annotation Symbol
CG10002-RB
FlyBase ID
FBtr0300259
Feature type
Associated gene
Evidence Rank
Length (nt)
4030
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 51 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GCACAGCACAACTCCCAGCTTCAGACTTCAGTGGCCAACAGCCAGCTAGATATTCACGTTCGTGCGTCGGTGTTTTGTGG
    CCGCTCGGTGCGGCAGACAACAAAAATCCCCATACAAAAATACAAAGAAAATACAAAAAGAATCGAATCATAACAGAAAA
    TAAATATATATTTTATATGATTATCCCGCACAAATAATTAAACCACGGTGTGTGTTTACAAACAAAGCTTAGAATCAGAA
    TCAGAATCGCAAACGGAATCAGAACCTTCCAGCCAACAAGTGACAAGTGCCGAAGTGCTCTCGATAAAATGCCAGATATA
    TGCAAACCGATTGAAGCAGTGATAGTGCACTGAAATCACAGTTGATATACAATATATCAGAGTAAAGCCACGTTTTAAAG
    ACCTCCTTTTTGATTTTCGTTTTAACTAACGCGTTGCAGAACGCGTTGCCTTTTCCATCGATCCACCAGAGGGCAGCGCC
    TCCGAAAGCCGGCAACATAACGGCGCAACTATTGAACAGCTTTCTGAAGGGTAGCCCCCACCAGACCACCATTGACATCA
    TGCAGAAGCTCTACGCGGAGCCGCCTCCGAGCAGTGCTCCGGTGAGCATGGCCAGCTCGGGTGGCGGTGGTCCTCCGTCG
    GGCGGCGGTGGAGGCGGCGGCGGAGGAGGAGGCGGTGGGCCCCCACCGCCCAGCAATAACAACCCGAATCCGACGAGCAA
    CGGCGGCAGCATGAGTCCCCTGGCTCGATCCGCCTACACAATGAACAGCATGGGCCTGCCGGTGGGTGGCATGTCATCGG
    TTTCCCCTCAGGCGGCGGCCACATTCAGCTCCAGCGTCCTGGACTCGGCGGCGGCGGTCGCCAGCATGAGCGCCAGCATG
    AGTGCCAGTATGAGCGCCAGCATGAATGCCAGCATGAACGGCAGCATGGGTGCGGCGGCCATGAACTCAATGGGCGGCAA
    CTGCATGACCCCCAGCTCGATGAGCTACGCCAGCATGGGATCACCGCTCGGGAACATGGGTGGCTGCATGGCCATGTCGG
    CAGCGAGTATGTCGGCGGCGGGATTGAGCGGCACCTATGGCGCCATGCCGCCGGGATCCCGGGAAATGGAGACGGGATCG
    CCGAATTCCCTAGGCAGATCGCGGGTGGACAAACCAACTACGTACAGAAGGAGCTACACGCATGCCAAGCCGCCATACAG
    CTACATCTCACTGATCACCATGGCCATTCAGAATAACCCCACCAGAATGTTGACGCTCTCGGAGATCTATCAGTTCATCA
    TGGATCTGTTTCCGTTCTACAGGCAGAATCAGCAGCGCTGGCAGAACTCCATTCGACATTCGCTGAGCTTCAACGATTGC
    TTCGTAAAGATTCCCAGGACGCCGGACAAGCCAGGAAAGGGATCGTTTTGGACTCTGCATCCGGATTCGGGGAATATGTT
    CGAGAACGGGTGCTATTTGCGGCGACAGAAGCGTTTCAAGGACGAGAAGAAGGAGGCCATTAGGCAGCTGCACAAGAGTC
    CGTCGCACAGCAGCCTGGAGGCCACCAGTCCGGGCAAGAAGGATCACGAGGACTCGCACCACATGCACCACCACCACCAC
    AGCCGGCTGGACCATCATCAGCACCACAAGGAGGCGGGCGGAGCATCGATCGCCGGCGTAAATGTCCTGAGTGCAGCGCA
    CAGCAAGGACGCGGAGGCCCTGGCCATGTTGCATGCCAATGCCGAACTGTGCCTCAGCCAGCAGCCGCAGCATGTGCCCA
    CACATCACCACCATCAGCACCACCAGTTGCAGCAGGAGGAGCTGTCGGCGATGATGGCCAATCGGTGCCATCCGTCGCTG
    ATCACCGACTACCACTCGTCGATGCATCCGCTGAAGCAGGAGCCCTCTGGCTACACGCCCTCCAGCCATCCGTTCTCCAT
    CAACCGCCTGCTGCCCACGGAGTCCAAGGCGGACATCAAGATGTACGACATGAGCCAGTACGCCGGCTACAACGCCCTCA
    GTCCGCTGACCAACTCACACGCTGCCTTAGGCCAGGACTCCTACTACCAGAGTCTTGGCTACCATGCGCCCGCCGGAACC
    ACGAGCTTGTGACATCACCAATACCCGCTGGCTTAAGGACGCGCGGAGCAGATGCTGCGCTCGCAGCAGCAACAGCACTT
    GCAGCAGCAGCACCAGCAACACCAGCAGCAACAGCAGCAGCACCAGCTGCATCAGCAGCAGCAGCAGATGCAGCAGTCGG
    CGCAGCAACTGACATCCGCTTCCAATACACCAGCAACATCAGCAAAGGCCAGCGGCAAGGCGGGATCGGCTTCGGCCTCG
    GGATCTGGGTCAGGATCGGGTTCAGGATCGGGCTCTAACTACTCACAGAAGCTGCAACAGCAGCACCAGCAGCAGCAACA
    ACAGCAGGCGGCGGCGCAGCAGCAACACCACCAGCAGCAGCAACAACTGCTGCAGGAACTGCAGGAGGACTCATCGAACA
    TCACCAGCGATCTGAGCGAGGAGCAACTGCAGCAGCATCAGGCCGCCCAGCAGCAGTTGTACAACAACTATCAGCAGTAT
    GCCGCGGCGGCAGGCTACAGAAATTGGAATCACGGCCTGGCTTTCAATGGAGCCGCCGCTCTGCAGAATCTTCTGTAGCT
    ATAGCTATAGATCCCGATCTCCACAGGCAGCGGCTTTGTAGCGGGCCTGCCAATTAGCGAGTGCAGTGGCGGTGGCTTTT
    AGCACCTGGCCGCATCCGCATCCGCACTCGCATCCTCATCCTTTGAGCACGTGAGTCTTGGGCCGCAACTCGCACTTGTA
    CATATAGAGATACCTATGAAGAGCCGATCGAGAGCGCTGCCTTTTGTGTTGTTCAGTTCCAGTACTATATATTGTAGATT
    ATATAGATTCTGTTCCGGGGGGTTATTAAATCGACATAGAGCAGGAGGAGGAGGAGCGAAAGAAACCGTGATGTAGTTGT
    AAGTGCAGCAGAACTTTTGTTAACAATTTTACGTTTTGCTAATACAAATACAAAATAATAATTCCGTGCCATTTGTTTTC
    GTTGTTTCGAAACAAGCAATAACAATCAAAGCGGTTATAACTGAAAATTTGAAATCACATTTTAAATGTATCCGATTAAG
    GAGAAGATTGAGGAGAGGAGATGTAAAGAAGGGATCGTGTGTAATGTTCTTTCATAAAACAAAGCCCCAAATGAAACAGT
    CCCAAAAAGAGAGATACAAATACTAAACCCTTTATCCAAAGGCAATCGCAATCGAATTCGAATCGCAAAAGATCAAAACC
    AAAAAGAAATCTAAAACCGAAATCATCATATTGAGCAGTCCAGCAAAACCCTAAGAATCTTCAACTATCTAAGCAACAAA
    ATCTGGCCATGCATAAGAAAACGACACGTTTTAACTGAATAATTTAACAAATTTCCATTTATATATACGCGCATCGATAT
    ACGCCCATGTATCGCAAAATCCCGCATTTCATTTACATTATGTGTCTTCTGTTGTTGTACGAATTCGTTAGATTAAGGCA
    TTTTGTAAATAATCTATAAATAGATACATTTAAGCAACCCCCTCCCCAAGAAACCCAATTTAACTAAGGACCCATTGCAA
    GCAACCAATTTTTAACTAACTCGAGAATTAATCAAATTGTATGAAATTATGCCACACCACTTGAAAGTAAACATAGTATA
    AATATAAATACTGTATAGCATTTAACGTTTAATTAGCATAAATAATGAAAGCAAAAAACAAAAATGAAAAAAAATCACAT
    AAAAAGCGAAACTGCAATTATTATTCAATAATTTTTAATATTAGTTATATTGTGCGTAATGAAAAATAAAAAACCAATTG
    CAAACACAAAACAAAGACCCATTTTTACATTGAGCTAAGCTAATTAATTAAACTTGATAAAAAATAGTCTAAATATAAAC
    ACCCACACACACACACACATACTGACACTGACAGACACAGAAACAAATGAAAATTATTGTAAAATACACAATATAAAATT
    CAATAAATGTCAACGCAAGAATTAAAATCC
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0085321
    3280
    FBtr0330333
    4030
    FBtr0345227
    4289
    FBtr0346765
    4030
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0289487
    510
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0084690
    510
    FBpp0303365
    692
    FBpp0311419
    510
    FBpp0312360
    518
    Comments
    Transcript terminates at site supported by polyadenylated cDNA.
    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    fkh-RB
    Secondary FlyBase IDs
      References (0)