General Information
Symbol
Dmel\cg-RJ
Species
D. melanogaster
Annotation Symbol
CG8367-RJ
FlyBase ID
FBtr0290035
Feature type
Associated gene
Evidence Rank
Length (nt)
4692
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 89 )
Sequence
CGCACACACAAGATGGCGTCAGAGAACGAGAAGCACGAACACTAAGGAATTTGTTCAGTGGTGTCTGTGTCTGTGAATTA
TATTGAAGGAAAAAGAGTGTTTTGTTTATAAATTTAATTGCAAAAACTGCACATCGTCACACGGGGCGCGTGCACACACA
TCGGCGCACACGCACACCCACGCCAAGGCGACACCTAAACGCAAAACGGAGAGTGTGTGTTATCAATGGAGTGTGTGTTC
CCCAACGCCAAGTGAATTTTTTTCGTTGAGACCGAGGGACGGAAAAAAATGGCGCCCGCAGCCAGAGCAACTTGACTTTC
TTTTCGGTCCTATATAGTTAGTAGTTGCTTGCCCCCGTCTCGTCGTCGGCGAGCGAATTCGGTGATTTTATTTCGATTTC
GTCGCAGTGCGATATCCCCAACGAAGAAAACATAACGAATAATTGATGAAAAAGTGCTTGAGAGAGACCCCCCCAAACGT
ATTCGAATTTGTTGTGTACATTTTGGCTTCGAACACAGCCGCAAAAATACCATTACCAATTTCCACTTACTACTACTAGA
GAGGAGGATAGTATTTTGTACGTGCTTTAGAATACATACATACATACCTACATATACCACAAGCAAGCGAGAAGTGCAAT
TACATTTGCGTTTGGAAATTTTGCGCTTTTTTCTCTTCCGTCCTCCCATCCAAAAAAAAAAACCCCCCGCTCCCCCTCTC
TCTCTATCTTTCTCAACCCGCATTGTGCTAAATAATGTGTGCCGCCCAGAATCCGCCGCCCTTCGGCTATACCTGGGGTT
TTGCGGACAACGGCAACCGCGCCGCCGAATCGGTACTGGAGATATCGCCCAACATCAACTATACAGTCAGCGGGGAGTCG
ATGCCCTATCTACTATCGACGGATGGATCATTGGCAGTTCAAAAGGATGTCAAAGGCCTTACAGCTGGCGGCAAAAATAA
TGTCGTTCGTCGTATGTTCGTCGTAAACGATCCTTCATTTCCGCCTGGAACACAAAGAGTTATCACTGCCGGCGGAGCAT
CGACGGTGGTCAAGAAGCAGGACAACAATCAGCAGGTCCTGAGCCTCGACAAGAACTATCTGCTAGTGGATCCGGCCACG
GCCGCAGCAGCTGCAGCCGCCGCTGGTGGGGATTCGGGTCTCGCCCACCACCATACGTTGACCAATGGCAGCATTGTTGA
TGCGAAGACCGGACAGACGGTGCTAACCGCCGGATCTGCGGCGGCCAAGTCGCACTTCAGCTCGATCGGAGCACTGCATC
TTACGCAAGAGGAGTGCAACGAGATCCTGATCAAGCGCGCCATCGCTGCCGGCCACCATCAGACGCACACGATCACCGCT
GCCGACGGATCCCATCACCATGCGTCCGGCGGGACACCAAGTGACATACTTCCTGGTATTTCAGTTCAAGTGCAGAAAGT
CATACAAGGACTGGAGGATAACGAGGACTCGCAAGGCGAAGCACCCAACCTAAAGTTGGAGCCAGGCACATTAGAGTTGT
CCCCGAAGACCGAACTACAGGAATCAATGCATTTCAGCGAAACGGACGCCACCATCAAGAAGGAACGCCCGTACAGTTGC
GACGAGTGCGGCAAGTCCTTTCTGCTCAAGCACCATTTGACAACCCACGCACGCGTGCACACAGGTGAACGCCCCCACAT
CTGCACCCATTGCGGCAAGAGCTTCGCGCACAAGCACTGTCTCAACACTCACCTGCTGCTTCACTCCACGGAGAGACCTT
ATCAGTGCCAGGAGTGCAAGAAGAGCTTCACCCTCAAGCACCATCTGCTGACCCATTCGCGGGTCCATAGCCGGGAGCGA
CCATTCGTCTGCCAGGAGTGTGGACGCGCATTTCCGCTTAAGCGACACCTGGTCACGCACAGCAAGTTCCACGCCGGCGA
ACGACCATATGTATGCGAGGAATGTGGTGAGAGCTTTGCGCAGGAAAACCACCTGATTATGCACTCTCGCTTCCACGGTT
CATTGAATCCATTTGTTTGCGCCGAATGCGGAGCTTCGTTTCCACGCAAGTTTCAATTGGTTAACCACGGACGTATTCAC
GGCAAGATTCCCCATTCGTGCACCGTATGCGGCAAAGAGTTTCTACAAAAGCGAACGCTAGTTTCCCACATGAGGCGGGT
GCATACCGGCGAGCAGGCGCATCCCTGCGTCAGCTGTGGCGAGGGATTCCTCACCAAGGCCGAACTGCATCAGCATGTGA
GGACGGCGCACAATGGCGTCAATCCCAACACGAGCAGTGCCACCATCATAGCAAATCAACAGCTACAGCAGGCCCATCAT
CACCAAGCTGGACAGCAAACGCATCCGCAGACCATAACCGTGGTGAGCAATCCGGGCAACTCTACGTTGCTGACTGTATC
CACCACGGATGCCAATGGCGTGGCACGACCGCAGTTTGTGTGCCGCGAATGCGGCAGTGCTTTTAATAGCCGAGAAGCCT
TGGCACTTCACTTGCGCCTTCACACTGGCGACAAGAGCCTAATGACAGATCTGTGTGCCTTGACAGCCGCGCTGCCGGGT
CACTTCTTGAGCACGGCTAGCCTGAATCCGGGCACCGTGGTCACGGCCAATCCGAATCTGGTGGGCCAGAGCCCTGTGCC
AGTGCAGATCATATCGTCCACCGGTCAGGTGATGTCGCAGACCACGCTGGTGCAGGCCGCCAACTCGACCCATCCACAAG
CCGTGGTCACCGCTGTGCCTACGATGCCCGTGCATGGTCAGCAGCAGCATCTGCAGCATGTGGCCCAACAGCAGCAGCAA
CAGCAACAACAGCAGCAACAGCAGCAGCAACATGTTGTCTCCGTGGCGCCGGCCAACAAACCGAAGTCGCATTTCTGCGC
CAGCTGCGGCAAGGGATTCGCCGCCAAGCACGGTCTCATGCAGCACAATCGGCGTCACCCGAACGGCGGCTGCACGGTGC
GCACACACGTGTGCGAGTGCGGCAAGGCCTTCTTCCAGAAGAACCACCTGATGCTGCACCAGCGCCAGCATCTGGAGACG
AAGCCAGCCATATCGCAGCAACAGGAGGCCGCCACCCAGCAGCAACTGGCGACTGCCGGCGAGCAGCAGCAGGTACAGGT
GCAGATAATGCCTGATGGCCAGATTCACGGAAAAGTAATCAAGTACGAGATCTGTCGCAATGTAATGCCGGAGGATCAGC
AGCAGGAGCAGGCGGACATGAACGCGGAGTAATTCAGATAAACTGTAAATACATGGGACGTGCAACTGCAACAGCAGCAA
CACAAAAGTAGCAACAGCATCAGTAGCAACATCATCAGTAGCAACAGCAACAGCATCAGCGCATAATGGGACACCAGCAC
AGTTGGACGGAGACAGGCAGATACCCACCAGAAAAAGGTCATCGGAGTGGGGCGTATGCATCGTAAGCGATTCCCTTAAA
TGTAATATTTTAGTTAGCCTTACGTTAGCGGTTAAGTGATCGGATTGTACACATAAATGTTAACTAGCGTTACACACATG
AACACACCTTATATAATATATATATACAGACATATATAGGTTTACGTAGAGTATCTGTTAATTTTTGCGATGCCTTGGTC
GCATCTAAAACAACAACCTGTATGAGTTGCAAGTTTTAAAGCGTTACGTTCAATTGGTTTTACGCATTACACGATTTTTA
ATAACACAACTTATACACAAACTTATATTCAAATAGACGAAAAATATTTATGCCTAAGTGTAAACTGTATACATATTAAC
ATGAAACATTGACGACTACGGATAGTACTAGACACTAGCATGCGTTGCACTTGAATACGTAACCAGCTGCCGATCGAATC
CGGACGTGGGTGTTTGCGTGGTCCTCATCGTGGGCGTGTGCACTTCGTTTCGAAGAGGGGGGAGGGGGGTATTCCTGCCC
AGAATCGCGTTGGTGCAGCATTTTTTGATTGTACATACAAAAACCGGAGCTCGCTACAAGCCCAAGCGAATGCAGAACAG
GTCCAAAAGAGCGCAGACACTCCAGTCGGAGTCGTCTGGGGTCTGAGGAATGTGGAGTAGGTGCCTGGCACAAAAACTAG
CTAACACAGATAACCAACACGAGAGGCGGGAGAAATCTTTAACATAGGTGACTGCAATTGTTTGACAACCCAAAAAACAC
AATCTAGCAAGCGAGAAGAAACTTAACTTAAAAATTATCCAATGCAAATAGAACACGAGAAGCAGCTAACAAGAACAGAC
ACTCTTATAACCGACCCACATCATCATCCAATGCACGCTTGGCGACGTATATCACACTGTAAAAAATCTACATTAAGTCT
TAGGAGCGAGTTAAAGCAGACGGAACATAATTGGTAATTATCGTAATCGGATAAATGAAACAATAAATAATGAACCTACA
CACTAAGCATATATTTTAATATGTAAGCCTTAAAGAAATACAAAAGGAAAATATGAATTATAATAAACAAAACAACGTGT
AATTGCAATCATTGCTGGCTGCATTGTTAATGAACAAAAGTACGTTCACCCTTTTGAATGTATTAGGTTGGGTCTTTTAT
CTCTAGATATTTTTTTAGTTTTCTATCTCTTGATAAGAACAGAGCCACATATGCCATTCATAACATTAGAAAAGGCTTAG
ATATAACCATTTTACCATTTTGTCGTAAAATGAATAAAGTTTAATTTGAAGC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0087529
2881
FBtr0087527
3361
FBtr0087528
2866
FBtr0087526
3058
FBtr0112795
5066
FBtr0290034
3364
FBtr0339960
3040
FBtr0339961
4728
FBtr0339962
3385
FBtr0346946
4814
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0288474
825
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0086658
671
FBpp0086656
772
FBpp0086657
629
FBpp0086655
671
FBpp0111707
770
FBpp0288473
773
FBpp0308982
665
FBpp0308983
837
FBpp0308984
780
FBpp0312412
686
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
cg-RJ
Secondary FlyBase IDs
    References (0)