General Information
Symbol
Dmel\CG12355-RB
Species
D. melanogaster
Annotation Symbol
CG12355-RB
FlyBase ID
FBtr0113333
Feature type
Associated gene
Evidence Rank
Length (nt)
817
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 13 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTCAGTAAAGCTCCGTTAGCGCTGGCGGCTGGCCGCTTCCAAAAAAAATTCATTAGAAAGTTGTCACAAAAAATTTGTTA
          TTAATATTAATCAAAATTCAAGCAATTAAGATAATGGCTCGGTTAATTTCGGGAGTTCGCAATTTGTTCCATCGATATCC
          ATTCGTCACCAACAGCGCCATCTATGGGAGCCTTTATGTGGGCGCCGAGTATTCCCAGCAATTCGCATCCAAACGCTGGT
          TGGCCACGGCGAGCAAACCTGAGGATATCGATTATGCAACAATAGGAAGATATGCCGTGATGGGTACTGCAGTATATGCC
          CCAACACTTTACCTTTGGTACAAATGGTTAGATCGCGCTTTTCCTGGCACCACTAAGGTTATCATAGTTAAAAAATTAGT
          GCTTGATCAGTTTGTACTAACGCCTTATCTATTGACTGTGTTTTATGCAGGCATGTCCATCATGGAGGGCTCTGCGGATA
          TTTTCCTGGAACTCCGCGAAAAATTCGTGCCGACTTTTATGCGTTCCTGCATTTTCTGGTTGCCCGCGCAGGCCTTGAAC
          TTTTCCCTGGTTGCACCCCGATTCCGTGTCATCTATATGGGTATTTGTGGATTGATTTGGGTGAATATTCTATGTTGGAC
          CAAGCGGCAAAGTCTTCCAGTCGCAACGAAAGAAATTGCAACTGATTCAAATAATAATGCAGCTGCCATAAGGAATTCCG
          AAACATGAGATTTGAATATACACCATACACCATAACCATGTATATAGTCCTAGATAGTTTTTGACCATGCATTGCCAAAT
          AAAGGAGAAGCAAATAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0075606
          818
          FBtr0300758
          791
          FBtr0334086
          1026
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0112245
          204
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0075359
          91
          FBpp0289982
          91
          FBpp0306211
          204
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG12355-RB
          Secondary FlyBase IDs
            References (0)