General Information
Symbol
Dmel\CG11357-RB
Species
D. melanogaster
Annotation Symbol
CG11357-RB
FlyBase ID
FBtr0113142
Feature type
Associated gene
Evidence Rank
Length (nt)
2326
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 15 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GGGAAATCATCTACCTGTGAATGAGTTATGGCAGTCACTTGGATCTGGAGTTAAATGGCCAAGGCACGCAGAAAACGCTA
        CCGTCTGAGGTGTCCGGAAATAGAGTTAGATCCAATTAGAAGCCGCTAGGATGGACAAGCGATCGTTGTGCCTGCTGCTC
        ATCTGCATCAATCTGTGCCTGGTCATCTGGCTGGTCAGTGTGCAGCAGTTGCCGATGCTGGAAGCGGAAATCATCGCCGA
        TTTTAGCGGAAGTGGCGGCATTAGCAGCAGCAGCACCGCACAGCCGCCAACGAGTGCCAAAAGTGGATTGCGGAGGAGCA
        GGAGCCAACCAAACCAAATACACCAGCCTAGTCGCACACCTAGTAATAGTAATGATAGTAGCCTAGTTAGCAACACATTC
        GATAACCACCCCATGGGCACGCCCCCCACTTTGGCGTCACAAACGCCCACGCCGCCACAGAGCAGCATGCACCTCATGGA
        TCTGCCCAATTTCGTCTATCTAATAGACCAGCCCGCCTGTGATAAGGATGTCCGGGCACTGATATTGGTCCATTCGGCAG
        TGCGCAATATCGAAAAGCGCCGGATAATCCGAGAAACGTGGGCGAATCGGAGCTATATAGACCAGACGCCGCTGAAGGTT
        TACTTCCTGGTGGGCGGGGTGAGCGCTAAGAGCGAGAAGTGGCAGCAGTTCCTGGGACGCGAGAACCACCTGCACGGCGA
        TCTCATCCAGGGTAACTTCAAAGACGCCTATCGCAACATGACCTACAAGCATGTCATGGCTCTCAAGTGGTTCAACGAGA
        AGTGTGCGCATGCCCAGCTGCTGGTGAAGGTGGACGACGATGTGTTTATGAACACACCGCAGCTGGTCAAGTACTTGGCG
        ACACCCTCTCTGCCAGAGTACTCCATGCTCCGGGATCCCAATCTGATGCTCTGTCGATCCGTCCATCATTCGAGGGTCAA
        GCGTTCATATCGTTCCAAATGGCGGGTGACCTACAAGGAGTACCCGAATCGTTTCTATCCGGAATACTGTCCCGGAATGG
        CCATTGTCTACGCACCGGAAGTGGTGCGTCGCCTGTACGAGGCGGCCCAGAAGTCCAAATACTTCTGGGTAGACGATGTA
        CTCATCACGGGGATCCTGGCCGAGGAAACGGGCAGTAAGATCACCCCGCTGCAGCATTACCTCGAGCAGAAGGACGTTCG
        CAAGCTGGTCGGCGGGGAAGCTGATCTTGAGGATCCCCCGTTCCTCTTCACAAATCACGCCATTAAGCCAGACGAAAGCA
        TGACCATTTGGCAGATGGCGCTGGACAGAATGCAGAGGCCACTGCTCACACAACCCGCCTACTCATCCGCATCCTCCGCT
        TCCAGATCCGCACCCGTTGCGCCAAGTGCCAACATTTCCGAGGTGGCCCAGACGAGCTCCACCGGCCTCAGCTAGTTTGA
        CTGGCACCACTCGATGGATTGATTACGTTTAGTTTCTTTGGCTGTTCAGTTTTAGGGTTTCGTTAGGCCTTAGTATTAAC
        TCATAGTTATCCGTAATGTTAGCTGATTAATGAAAGGTAGCATTTTTGTCGAGACGAATACAAACGGAACATTGCAAGTC
        AAGTGAACCACCAACCACCTGCCTACAATCATTCGTATCATATGAACCGTAACTAATGTAAGGATTCTACTGATAGTCAT
        GTACATCCAACGCGAATCGCTCACCAATAGATAACCGAAAATCCAAAAACATAAATGAAATACGAACACCAAACTCTAAT
        AGCGGCAACAATAAACGGAGCGCATAACCTTAAGCACAACTCTTAAATCGTAAGAAAACTACAATAGTACTTAATAAACG
        ATAAAATGATTGAAAACTGCTGAAATCAGTGAATAACCAAACCAAATATTGATTTCGATGTAGATCGCGTAACAGTGGAC
        GGAAATATTTATTAAAAAGTATATATACGTAGGGGCAAACGAAAAATAATAATAAAAATTACCTATTTTTTTTAAATGTT
        TGTATTTTAAAGCTATTAAACAGTCTGTATCGTTTTGATCCCAAAATTCCAGTAAAGCCAATTAATGGAAAGTCAGAATC
        TTCATATGCATTACATTTAGTCAGATATACTTAATGAATAAGATAAGTGGGAACAGAAATGGCAGGAACGTTAACAAGAA
        ATATCAAAAACAAATAGCAAATTGTACGGTCCGAGAACGCTAAAATCGATGAACGAACGAAAATGGTAACAAATGAAATT
        TATAAATGTGTAATAAAACTAATTAAATGTTCAAGTTTGTCAGAAATTATATAAAAGTCATTTCAAAATACATAAATACA
        AAATGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073310
        2686
        FBtr0113143
        3080
        FBtr0304987
        2611
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0112055
        434
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073166
        434
        FBpp0112056
        434
        FBpp0293524
        434
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG11357-RB
        Secondary FlyBase IDs
          References (0)