General Information
Symbol
Dmel\NFAT-RB
Species
D. melanogaster
Annotation Symbol
CG11172-RB
FlyBase ID
FBtr0112980
Feature type
Associated gene
Evidence Rank
Length (nt)
5651
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 92 )
Sequence
TGGTAGATACAAACAATTAAAGCAACTGCAGAGCAAATTTACCAACAAACAAAGCAACAACACACAAAACAAATGTACAA
AGTCAATCCAAAATTACAAATATTAATTTAAAACACAAAGAAACAATTAAATGTGCCAACAATATTTACCAAATCAACAA
AAACAATACAAGTCAGAGGGAAGACAACAAAATCGATGCCTGTAAACATAATTATAAAATATACTAAAAGCACTTATCCC
AAAAAGAGAACGAGAAACTCGAGGAGAGAGTAGAAAGAGTGGAAAGAACAATCACTAATCGAAAATAAATTAATTGCACC
ACAAATAGCCATAAGAGTTAATTAAAGTTATTTAAAGAGTCCAGTGAAAATCAATCAAAATGCGATTCACCTACAATCAG
TATAAACATTATGAGTCCGGTTATCGGATTCCATCTAAAATGCATAATCTGAGCCATAATAACAACAATAATAGTAATAA
TAATAATAATGGGGGTGGCCACACCAACAACAACAACAATGGCAACAATAGTGGCCATCACTATGCCCATCACAATAATA
GCAACAATGGCGGCAATAACAACACAAATTTCCAAGCCTATCAGCATCATTACAAAAGTAATTTCGGCATGAGAATGACC
ATGTCCACCAATTCCACAATGAGTGCGCGTATACATCGAAAAGGATTTCGCATACCATCGAAAAGACAGCCGGGTAAGGG
ATTGCCCGGCAAGTTGCACACCATAACCAGGACGGGTCCTGGCAAAATGGTTCCTGGGAAGCGAATACCACAGCGACCCC
ATCCGCCGCCCTGCGACAACTCGAACGACAGTGGGCTGGGTTTCGATCAGCACACGGAGCTGAGATCCTCGGCAGGAGCT
GGGGGCGTTACTGATCCGGCGGCCAATGGAGGCAGTGGCTCCAACTCTGGCCAGCGATCCAGTTTGCTGGTCAATAGCGC
TTTAACCAACACAGTGGCTGCTGCAGCAGCCGCAGCAGCTGCCGCGGTGGCCAGCAACACGTTGCAGCAGCATCAGCAGC
ACCATCAACAGCAGCAGCAGCAACAGCAGCAACAACAGCAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAA
CATTCACCGCAGCAGCATTTAATCAGAGCGATACCTGTATCAAGATCGCGGAACAACACGAAAGTGATGGCTCACTGTCT
GGAGGATCTGGACCTAATATCGGCGTCCTCGGAGGACAGCTCGACCATCGCAACGCCGGCCGGTTTGGACGAGGACACGG
GCTTTGTGAACGACACCAAAACGACGACAACCGGTGGCAATAGTAGTTCGGATCCATTTGGAGGCGTCTTTCAGGCAACC
GAGGCAGCCGTGGCAGCAGCCGTTAATGCCTTCAACTTGCAACAGCAGCAGCATTCGGTGCAACAGCAACAGCATCAACT
CTTTCAGTACAACGGATTGCTGTTGCAGCCGCAGCAGCAATTGCAGCAGCAACAGTCGCATCACCAACAACAACAACAAC
AGCAACAGCATCACCGCCATGGCAAGCATATCAAACGCAAGAAGCTCGAGTGCAACCAAGTGGAACTGGACAACGATGAT
GCCTGCAGCGAGGATGAGTTCATTCGCAAGATTGCCAGTTCGGTAACGATGTCACCCACGCTTGAGGCCACGCCCTCGCC
GCCGCCCATTGTCGCCTCCGTTGCACCTGCCACGACCATTGTTAGCCTTCTGCCGCTCATCAGCAGCGGCAACAGCAACA
ACAACAACAACAACAACAACATTGAGACAAAATTCATATCGGCCAGGAATGTCACGCGTGTGGCGAACAAACGTCAACCC
ACTACACCGCTGAACAGCGTCGCCAGCTCCAACGATGGCCAGGTGCAGCTGGAGATTTTGTCGCAGCCGGAGCAACAGCA
CCGGGCACGCTATCAAACGGAGGGCAGCCGCGGTGCCGTCAAGGATCGCAGCGGCAATGGATTCCCGATCGTCCGACTGA
CCGGATACGATAAGGTTGCCGTCCTCCAGGTCTTCATCGGCACGGACATTGGACGCGTGGCACCGCACATGTTCTATCAG
GCCTGCAAGGTTGCCGGCAAGAACTCGACGCAGTGCAACGAGAAGAAGGTCGACGGCACCATGGTCATTGAGATCGATTT
CAAGCCCGAAACGGACATGACCATCACATGCGATTGCGTTGGAATCTTGAAGGAACGCAATGTGGATGTGGAGCACCGAT
TTCCCGAGCATCTGGCGCAAAAGAACAAGAAGAAATCGACTCGCTGCCGGATGGTGTTCCGCACCCAGCTGACCCGTGAC
GATGGCACCACCGAGACCCTCCAGGTCTGCTCGAATCCAATCATCTGCACTCAACCACCTGGCGTGCCGGAAATATGCAA
GAAATCCTTAAACTCATGTCCCGTTGATGGCGGCCTCGAGCTTTTCATTATCGGCAAGAACTTTCTGAAGGACACACACG
TGGTGTTTCAGGAGACATACGACAGCGTCAACGGTGACGATCCGGCCACGGAAATTGCAGTGCGCCAGCAGCTCATCGGC
GGTACAGCCGCTCTTTGGGAACAGAGTGTTCTGCCGGATAAGGAGTACCTTCACCAGACTCATCTGATATGCACGGTGCC
ACCGTATCTGCACCAGAACATCCTGAAACCGGTCCAGGTTCAAGTGTCGATCGTCTCCAGCGGCAAGAAGAGCGAACCGC
ATACGTTCACCTACACGGCCAAGGGACAGTACACGACGCTGGCGGCGGCCAGCACGTTAAGTAACACAATCCACGCCCAA
GATGTGAGCGGTTTCATGGACACCACATCAGCGTCCAATGCGAGTGGCTCCAGTGGTTGGAGTGCGGCAGGCGGTTCCGG
CAACAATACATCTACAGGCGATAATGTGGAGGCCAAACACGAGATCGATTCGGGCATGATGCCTCCGCCCATTACCACCC
AAATACCGATGGGCGTTCGACGCTCCTCGCTGCCCAGTGTCACACCCATGATCACGGACCAACAGCTGGTCCATCTCAAC
GCAGTGGCGGCCAGTGCCGAGGCCCTGAAGACGGAACTCGACGACAGCAACTCGCATAGCCCACTGACCGGTGAATCCAC
ACCGGATAGCCCCAACGCAGCCTTGCAGTATCATCGCTTTGCACGAAAGCCCAGCCTGGACACCATTATGTACGATCAGT
CGAACAGTCTGCCCGGTTTCCCGACCGTTGTGGCGCCGGCTACAGCTGCCGCCGTGGCCGCTGCAGTTGATATTGATCCG
ACGGCGGTGGCCGTGGCGGTGGAACTGGCCGTAAAAAATGAGATTGTCAAGCATGTCGTACAGCAGCACCAGCAGATGCA
GGAGCAAATGCACGAGCAGCAGCAGCAGCAACAGCAGCAGCAACAACAACAACAACAGCAGCAACAACAACAACCCCAAC
AGCAGCAGCAGCAACAGGTGCACAAGTTTATTGACGAGCTGACCAAATCCACATCGGTGGTTTCCAGCAATGGTACCACC
GAACCAGCTCTGTTCACCACCTCGGCGGTGATCGATCATGCCCTGACCGATATTCTGCAGGCCAAAGTTGGCATTGCGCC
GCCCAATGTGGTGCTGGAAAGGAGTTTGTCCCTAAGCTCCACAAATTCCAGCAGCTCCATGAGCGGCAGTGAGAGTTCGC
CGAATAGTTCACCTTTGACGCAGGATATCATACTCAATTCAGAACCGGCAGCAGCTCTGGCCGGAGCTGCTGCCTTGGGT
GGCCCGGCGCCTGTCGATGTCACCGGTGGTCTGTCCACCGATATCATTATGAATCCCGCCGTTTCACCATCGACTATTTT
GTGCTCCGCAAATGGAGCGGCCACTGCCGTAGTGCCGAATATACTCGCACCTCACCAAGTGACCATGGCCAACTCCATTT
TGAACGATATTGCCATGCAGCCGGAACCAACACAGCAGGATGCAGCAGTAGCAGCCTTGGCGTTGAGCAACATCATGATG
AGTCCACCCACCGCGGCATCGGGTGTGGGAGTTGGTGACACACTGCCACCAACACCAGCTACTATGCAGCCAGAGGTCGC
AGCCACTGCCACATCCACTGCGGTCAGCAACATGATTATTAAGGCGGCGGCGGACTTTATAACCACCCAGGAGCAGGAGC
AACACCACTACCATCACCACGGTCGCATCCACTCCCATTCGCCACAGGCAGCTGTCGGAGTGAGCGGTAATCCTGCCGAG
ACGGCATCGGATCCATTGGTTGACCTGCTATTGAACCACTCAAACACACCAGAAACAGCGGCTGCTGCCGCTGCCGCAGT
AGCTGTAGAAGCAGCCAACTTCCAGTCGATGAATCACAGTCACCACAGCCATCATGGTCATCATGGTCACAGTCACGGCC
ACGGCCATAGTCGCGTCACAGGACACGTATCCGGGCATGTGACCAGCCACCATCGTGGTCACCACTTGCCGGTGGTGCCG
CCGACACCACAAGAATCTCTGATCGTTGCGCTGGCCAGCGAGAATGCTCTGCAAAAGTCGGTGGCCACCGCCGCAGTGAC
CACCAATGGAGCAGTGATGACGCAACAGGCATCTGCCCCGAACACAGCGGGTAGCATACTTCCGGCAGCGGTTGGAGCGG
TAGCTGCGGCGGCCGCCGTGGCGGTGCAGCCGCCCATTCCCCAGGAGCTGACCACGATGTCGGATCAGGATCTGATCAGC
TACATCAACCCGAGCACCTTTGATCAGCTTTAAACGGCTTCAGATCAACAAATTAAACTATGTGGACTTGCTTTTTTTTT
TATCAACTATAAATGTCACTCCTACACAGGCTTAGGCTTAAGTATATATGTAGTATATAGAGACATACACAAACAAACGA
TAAGACGGAATAAAGGTTTCATGTGGACCAACTTTTTGACCAAGAGAAAGGAGTAAAAACGGGATCAGAGAATAAAAACC
ACAAACACAAACAGATTTGTAGCTTTAGATTTGCTTACGTTTAGGCATAAACCCTATTTAATATAATTACCTAAATTTAA
TGTTTTTTTTTTTTTTGATTTTTTTTGCTATTTTAATATTGATTTAAAAAACAAATGATGAACTTATCTCAAAAGGTTAA
ATTAAAACAATGATAACGACTGCCATATACCTATGAAATATGAAGTGAAATCCCGAAAGTGAAGAATGAAAACCGAAAAT
GAAAAATTCAGTTATCAACCTTGAAAATCGATAATTATAGAAAGAACCAACTTTCATAAAACAAATGTTGATTACGCTCT
TTGCTGGAAGACCTATTTTTATAATTAAGTCTGATTTGAAAACTTCCTTTTTATTTGTTTGAGAATTTTAGGTATATTTT
ACAATTAAAGCCTAACTAAATGTTTTGGCAGTAAAATTAAGCTTATTTAATTTTGGGTCAAAAGAAAACCACGAAAAGAA
ATTATTATTATACAGTTAATAATTTATAAAAAAAAAATACATATTATGTGTAGCTACGAATATAATGAATATGCGAGAAA
TTCCAAAAGACTTTTGATTTAAAGAAAATGCAATTATTATTTTGTTTATGGTTTAATCATTTTTATTTTCAATTATATTG
AAGGAACGACGAACACACACAAATAAAGTTGTAACTGATGTTATTACTATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0073808
5870
FBtr0301449
5935
FBtr0301450
5243
FBtr0301451
6009
FBtr0340396
5781
FBtr0345127
5049
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0111893
1457
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0073639
1419
FBpp0290664
1248
FBpp0290665
1210
FBpp0290666
600
FBpp0309342
562
FBpp0311348
1248
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
NFAT-RB
Secondary FlyBase IDs
    References (0)