General Information
Symbol
Dmel\stumps-RC
Species
D. melanogaster
Annotation Symbol
CG31317-RC
FlyBase ID
FBtr0112893
Feature type
Associated gene
Evidence Rank
Length (nt)
4679
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 41 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCGTTTTGGCTTTGGCGTGGATCGGATCGGATCGGTTGGCCATAGTCTCCCCGAATATACAAGCCAATATACGTGTGTAT
      TTTATACTGTGCCGAGTGCAGCGGAAAAACTGAACCAAAAAAAAGTCGAGAAAAGTGCTCGTGACTGGAATTCCGTATTT
      GTTTACCATTGTGTGTTTGTGTTTCCATTGCTATTTGTGTTTCTGTTGCTCTGGAAAAGGGAAAACAATCGAGATTGGAT
      CAACAAGATTAGCGCGCCACCTAGCGGTCGGATTGGCTCTCCATCCTACAAATGTGTCCAAAACTTTGACGTATCCGCCG
      GAAGCACCTTAACTGGCTATAACAAGTGCAAAGCCCAGCAGGTGAAGAGCTCCACCAAAATCGAAGAGGTTTGGGGGGGC
      AGAAAAAAAACAGAGACCCCACCGAAGACTTTTCCAGCAATTATTAAACGGAAGGAATCGTAATGTCTGTGGACAACCCG
      TATTACTTTTGCAATGAAACCAAGTCGCCGCGCACCCCGGACTCGCAGTCCTCCAGCCGGGGATTCTCGATCTTCAAGCG
      GCGCAACTCGAAGGGCAGCAGCCCCCGGCCGCTGGTGATGACCAATCCGGAACAGATGCGACTGATCACATCCGCCAATC
      TGGATACCACGGCTACCATGGCATTAGGAAGTCCGCGGGGCAGCTTCAATTCCCTCGCCGGCTATCCGCAACACGCGATT
      GAACTGCAGACGATGAACATGTACCGCCAGCGATCTGCAAATTCGCACTCAGAGTTCCGGGAACGCCTGAATTCTTGCAA
      CGAGACCCACAGCTCCCAGTGTCCCGGAGGAGGAGGTGCATCCGTAGCTGGGGATCACGACGAGGTCTTCAATCCGCTGA
      CATCGCCAACAAGTAGCAAATCGCATCGACATCACACCCTGCCAAGTGGCGGAACTCGTCGCCATTCCCTGGGAAACTGG
      GCCCAACATCAGCATCAACAGCAACATCAACAGAACTCTGGAGCAATGGGACTGGGATCTCCGGATGAGGTGCCCAGCAT
      GATGGCGCCTCGACCGCCGCTCCTCTCGCCAAACAAATTCCGCGGCAGTTCCCATCGACGAAGAGACAACTGCGGCAACG
      TGAACAACACGAGTGGATCGAGTGCATCCGGATTCCTGGGCTCTCCCGGCTACAACATGGACGACATCCTGATCATCACC
      GCCAAGCACAGCGAGCGCGCCTATTTGAGGGCCACTTTCCTGAAGAACCACTTCGACAAGATCACCAAACAGCGCGGACG
      GAAACCATTCAATTTTCTGCACATCAAAATTGACGATGGTCCCTTCAGCGAGGAGATTGCCCACAAGTATCAGAACACAG
      CTTTGCAGATTGTGATCCTCTGTCCCGCACTTTTGGCCCTTCCTCACAGCTTTCTGATGACCCAGCTATCGGCCATTATT
      CGCGTGGAAAAGGTACTGGCCATTTTGTTGGATGTCAGCGAGGAGAAGGTGAAGGAGATGCACAAGTCGGCACTGCCCAG
      TTACTACAAGTGGCGTCGTTGTGTGGTGCGCGACAATGACCAGGTGCAGATCAGCAATATCCTGGGCATTGCCACCGATA
      TCCTGGGACGCGCGTTGTGCCAGCGACCACCGTGCCAGGATAGCTCTGGCGGAGGAGGTGGTGGTCTCTCGCGCAGCTTC
      TCTAGCTGCACCGAGGGATTCACCGTGCTGCCCAAGAAGGTCAAGCTGGGCCAAAACAAGGTGGTTGCTCTGCTGGCAGA
      ACCGCTGGAGAAGAACGACACCCTGAAGCTGCAGGTGGAGAAGTCCGGTGAGCTAATCGAGCTGCGCAACTTCAAGTGCC
      GCAATCCCTACACCCTGCAGTTCAATATCCCAGAGGCCTGCATGGAGATCTCCACCATGATCGAGATTCGCATCGAGAAG
      AACAACAAGAGTCTGGGTGCCAGGCCCATCAAGTGCGAGAGTCGTCTGCGGGAACTGGAGCAGCTGCTGCGTATTGAGGA
      CTCGCCAATTGAGTTCATGTGCCATGCCCTGGGAATTGGACCCGTGGAGCGGGATGCCCTCGATCAGCACTTGCTGCAGT
      GCTTCCAACGCAACATGCCACCCAACTTCCACCTGCTGAGTGGTCCCAGCGAGCGTCAGCCACACTTCTTCACCCGTCTG
      GAATCCAGTCCAGAGGAGTACCCCACATTGCTGCACTTCGCCGCCAGATGGGGCCTGAATCGCCTGTGCATCCAGCTGAT
      GGAGTGCCCAGGTGGCGACACCGCATGCGGAGTAAGAAACTGCGCCGGACGCACTCCGGCCGAGTTGGCCGAACAGGAGG
      GGCATCACAAGTTGGCCCAGAACATCGTCAGTTTCGCAGAGTTTCACGAACTGACCACCATGTACCACTACTTCAAGGGA
      GTGACTCCGCCAGGCGAGAGCTGTCCCAAGCCCAGTGCCAATGTGGTGATTGAAGCACATCCCGTTAAGGCCGGAAAGAC
      CAACAAGCCACCGAAGGAACTGCCCACGGCGGAGTATATGGAGATGTCCAGTGGATCGGAGCGGGAGAACACACCTGAAG
      TGAGGACCAAGACGGAAACCCTTGCTATCTCGAATCTCAACTACATAAGTGTGGAAACCGAGGACGAAAACCTGCAGGCT
      TCCGTGGCCGAAAAGAAGGTGGAATCTGAAAAGAAACTGCCCGAGGCTGGCAATCAACCTGGCCCGGAAAAGACCACCAA
      CGAATTGAGGATCAACGAGCCACCCTACTATCAGTCCAAAGAGCAGAACCAGCAGCCAAAGGAACTCAAGAACCAGAGCA
      AATCCCTGGACGAAGTGGATGCGGCGCCACTCTATCAGACCGACAAATTCAGCCAAGAGTGCTCGCAACTTTTGGAAAAC
      CAACTGGGCAATGACTACGTACTGCAGCCCTCCAATGTGCCGGTGGCCCAGGATGATGGCAACTATTTGTTCCAGCCATC
      GAATAGACCCGTGGAGGAGCCCCTCCGGTTAAATCGGTGCACCAACAGACAGCCCGGATATGGAACACTGAAGCGCAGTG
      CCAGCGACGCATCCGCCGCCAGTCACACAAGATCCAATGCCGACGATGAGCTGGCCGAGATTATGCACGATTTTAAGAAC
      AACGTGCTCTCCATTCGGGACGTGGAAGTGCTGGTGGAACGCTGGAAGCACCGCAACGATGTACAGCAGAGCTTCCGGGA
      GAAACAGGATCAGATCGACCAGCTGCGACGCGAGTACGAGCGCATCCAGGAGCAGGTGAAGTCTCATCTGAAGCGCGAAA
      CGCCTTTCGAGCGGATCAAGAAGTTCTTCTTGCGATCCAAGACACCTGGGGGAAACGACAGCCTGCTGGACGAGACCAAG
      TCATCGATAGCCACAAGCTGTAGCTTCAAGTCCGCGGGGGGCGTGAGCTCCAGCGCAGGAGCTGGACGTCCCATCAGTTC
      GCTGAGCCTACAGAGTGTGTCCAGCTCGAGTTCCTCCTCCGGCAGACTAAGCACCGGCAGCAATTGCAGTGGTGCCTCGC
      TGGGAGATTCGGGTACCCACTCGGATCACGAGGATCGTCGCTTCCCGCACTGCCGGATGATGGACAACTACATGGTGCCA
      CCGACACCGAGACCCGTCTTTACGCCCAGCTCAACGCCCGGTGATGAGCGTCATCAGATTGTATTCCCCTCGCCCATGTC
      CAGTTGCCAGCGCTTGAACACACCCACCAGTCCCACGGGATCCGAGCACTACCAAATGTTCCCCTCGAACATACCCGTGT
      ACGGCAGCCAGCCACTGGTTGGATCCCAGAGCAGCAACTACCTGAACACCATCATGGAGGCCAAGGAGCAGGCGGAGACA
      CAGCACTACCAAAACCAGAACGGAGTCACCCTGCAGCCCATTAAGCTGAACGAGCGATCGAACATCATCTACGGCAAGCT
      AACCAAGAGCAGCTCCGCCAGCGGATGCAGCTCCTTCAAACCCAAGCAGATCCCAGTACCATGTCCCCAGGTGGGCAGCA
      TCGAGGTCCAGGCCGAGGTCTACCAGAATGTGGGTGACGTTGCTCCGGAAAAGGACTCCAAGGCAGAGGAGGAAACGCCA
      AACTACATGAACTGCTAGGCCATCCCAACGACACATATTGTAATCGAAAGATTCGAAAGATTTTCATATATTGGTATTCG
      TTCGATTTACATGCGAGATTTGAATTTTGATCGAAATCGAAATCCTTAATATTTGCTTAGTCTGTAAGCTCATCCATTGC
      ATACTAAATGAAAGGATAAAATGAGTATGAACTAGTTATCGGTATTCTAATTATATGTTTAAGATATTCGAAAGAGTGCC
      TTGGGCCTTTGAAGTTTTTGAAACGGAAATTGGACAGTTAGAACATCAGAGGTCTCAAGATCACTTCGGATTACTTGTAT
      TATCTCTGTAGTCTTCGGTTTCAGCGACTAATTGTACATTTGTGAAACGATTGCAAGCAACCAAATCAACATATCGCTAG
      CCTTTAAGTATAGATCCTAAGTCGATACCAACAAACCAAGCAGCTGACATATCAACGCGATTCATTCAACTCTAGGAATA
      CCCACCCCATTTAGCGCTAAGATACCCACCTTTGGCATGCCGCTAAGCATGAAAAACTCGTTCATTCTCGACTCCTCAAC
      CCGCAAAGTTAAACGCAATAAATTTTTTTATATATAAGC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0082959
      3787
      FBtr0334955
      3822
      FBtr0334956
      4594
      FBtr0334957
      3643
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0111806
      1211
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0082418
      1012
      FBpp0306970
      1029
      FBpp0306971
      1220
      FBpp0306972
      973
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      stumps-RC
      Secondary FlyBase IDs
        References (0)