General Information
Symbol
Dmel\Rab26-RC
Species
D. melanogaster
Annotation Symbol
CG34410-RC
FlyBase ID
FBtr0112678
Feature type
Associated gene
Evidence Rank
Length (nt)
2078
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGCGGGATCAGCGCATCCCGACGACGCCAGCAGCATGAGCGACGACGTCTTCGAGGATGCGGAGACCACCCAGGCCAGGA
          TCGAGGAGCTGCGTCGCCGGCCCTTTGGCGATGGCTCCTACAATCCCCCCGCAGCGCCCGCCTCAGTTTCCGCCTCGATA
          ACGACGACAACGACACAGCAGCAGCAACAACATCACAATCCTTCGCATCACCACCAATCCTCGCACCACCAACCATCCCA
          CCACCATCACCACCACCACCACAGCCAGCTGAGTTTGACGGGCAGCCATCACTACCACGACGATGCTATCATGGCGCCCG
          TTCAGCGCTCGGCCACCGGATATCCTGGCTATCGTCCCTCCCGCGAGGCAATGCAGATGTATGCGTACGGAACGGATGAC
          TACGACGATGACTATAACGATGGTTGGCGATCGTATCGCTACGATGAAGTGGACATGCACCCAGCCCCGTCCAACGCCCA
          TCAGCAGCCCTTCGATGATACGGTTAACCACAAGACGATCCTGCTGGGGGATTCGGGCGTGGGAAAGACCTCCTTCCTGG
          TCAAATACAATACGGGCGAGTTCCGACTGGGTTCCTTTTCCGCCACAGTGGGCATTGCGCTTACGAATCAGGCCAATCAG
          CAGGAAGTAAAGAGGTTTCAAGAAGATGCGTCGGCAGCAGACAAGATATCGGAGTGATTCCATCGCTAGTCCGTCGGGCT
          CCCGCAAGCCCTCCATTTCGGTGGCCACCCCAACGCCGTTGGCCAGTGGATCCCCCACTCGCCGGGAGTCCCTGGTCAAG
          CCCACCTGGCAGCACATCACACCCGGCCAGCTGCCACCCAAAACGCTGGACAAGATCAATGGCATTGCCTCGGACGATTC
          GGACGACGATGGCTATCCGAAGAGGCGACCCAGCGTGATTGTCCACCAGCGCCAGCAGTCCATCTCCCAGCAGCCTCTGC
          TGCCGGAATACATGACCTCAGCCTCCATATTCCGGGATCATGCTCCACAGACATCGCAATCGCAGTCGCAATCACATCAT
          CTGCCATCTGGCAATGGTTTCATGGCCCGATTGAATAGCGTACGGCTGGCCAGCGCGACGGAGCAACAGCCACTTCTGGA
          TTCCGGAGGAGGAGTATCGGCAACTGCCGTGGCCAGGCCACCTGTTGCACCGGCTCCAGTTGCTCCGGGACCGGGAAGCG
          AGGGAGCCAGCGCAACGCTCTGCAAGAACGCTGGACGGGCACTCATCCGCATGATTTCATCGAGCAAGGCTCCGGAGGAG
          GAAGACGAATTCGATATCATGGGCAAGGTCATAATGCTGGGCGATTCGGGAGTGGGCAAGACCTCACTTTTGATCCGTTT
          CCGCGATGGTCGCTATGTGCCGAGCTATTTCCTCAGCACAGTTGGCATTGATTTTAGGAACAAAGTGGTGGTCGTCGATG
          GAACGCGCGTCAAGCTGCAAATCTGGGACACAGCTGGTCAGGAGCGATTCCGGAGCGTTACCCACGCCTATTATCGCGAC
          GCGCACGCTCTACTGCTGCTGTACGACGTGACCAACAAGACCACCTATGACAACATTCGCGCCTGGCTGGGCGAGATCCG
          GGAGTACGCGCAGGAGGACGTGGTCATCGTTTTAATAGGCAACAAGGCCGACTGCAGCGGCAGCGAGCGGCAGGTGAAGC
          GGGAGGATGGGGAGCGTTTGGGGCGGGAGCACAACGTGCCCTTCATGGAGACCTCGGCCAAGACGGGACTCAATGTGGAG
          CTGTCCTTCACAGCGGTGGCCAGGCAACTAAAGAGTCGCGGCTACGAGCACGGCGATGATGGAAAGTTCAATGTGCATGA
          TTTTGTGCGTGACAATACAAAGGCGCGCTCGGTTTGCGCCCAGTGCAGGAACATGTAATTGAAATTGGCCAACTTGCGGA
          TGACAGAAGAGCCATATCCTCCCGATCCCGCGCACAAAGACAACAATAAGCCCGCAGCCAGTTGAGATGGGAAGTGGGGC
          ACTCGAAAGGAAGCAGAAGGACACGTTCGATGGCGCAGAGTCGAAATTCTGCATTTATTGAAACAAACCCAAAACGAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0112677
          2518
          FBtr0301529
          1658
          FBtr0331794
          3311
          FBtr0331795
          1547
          FBtr0345428
          3355
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0111590
          410
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0111589
          388
          FBpp0290744
          410
          FBpp0304179
          410
          FBpp0304180
          373
          FBpp0311553
          388
          Comments
          5' UTR based on RNA-seq data.
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG34410-RC
          Rab26-RC
          Secondary FlyBase IDs
            References (0)