General Information
Symbol
Dmel\CG34376-RB
Species
D. melanogaster
Annotation Symbol
CG34376-RB
FlyBase ID
FBtr0112609
Feature type
Associated gene
Evidence Rank
Length (nt)
2357
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CTGTGTTAATTAGAGCCCAAATCAAAATCAATGCGCCCGTGGACGCGAACGACTCGAGATCGTGTGCGCGTGAATGCGGA
      TCGAGTAGTTGGTAGCTAGTTTATCAAATTCGAACCCTTGATATAATAAAAATAAAGGTGCGCGAGAATACGTGAATTGC
      GATTTTTGGCCCGTGAACGAATCACGAGCAAAGCGGATAAACAAAAGCCATAAAAAACAGATTCGCACGAGAATCATCGC
      AAAAGTCTGTGCGCATAAATTACGCTCCCCAATTGGAATTGGAAAAGTCTGGTTTTCGGCGAGCATCCGCATCCGCGATG
      GACGACGAGTTTAAGCTGTGCTGGAAGAACTTCCAGGACAACATAGCCAGCGGCTTCCAGAATTTGTACGACCGCGGCGA
      CCTGGTGGACGTGACCCTCGCCTGCGATGGAAAGCTCCTCCATGCCCACAAGATAGTGCTGGCTATCTGCAGCCCCTACT
      TCCAGGAGATATTCACTACCAATCCCTGCAAGCATCCCATCATAATACTCAAGGATGTGAGTTTCAACATTATGATGGAG
      CTACTGGAGTTTATGTACCAAGGAGTGGTTAATGTTAAGCACACGGAGTTGCAGTCGTTCATGAAAATTGGACAGCTGCT
      GCAGATCAAGGGCTTGGCTACCAATTCGAATTCCTCGCCAGGATCGAGTGTCTCGGAGAAGTCCTCTAGTCAGCCACCGG
      CAGAAGAATCAAGCAACACCAACAGCACCAATCATCACAACTCTAGCACTAATAGCAATAACAATAGCAAATCGGAAACG
      GATCACAATGAGTCCAAAGGCCAGAGCAATTCAAGAACCACTTCGCCAGGTGGTGCCAGCAGAGCCTCCAACGATGCCAG
      CCACCTGTACACATCGAACAAACGTCCGATGCCGTCGGATTTTGGCAGCGATTCCCTGTCCATTTACTCCGGCAAGCAGT
      TGAGACGCTCCCTCAAGGATCACGGTTCCGGCGGAAGCGAAGGCGGCGGAGGCGATCACGCGGATACCGCAGCCGGATTG
      GACAACAGCATGAATTCAGAGGAGTTCTTCTTGCCACCCATTCCACAAATCACGATGGGAGAACAGCGCTACGATCTCGG
      AGGTCTGAAACGGGAATCGGATGGTCACCACCACGGTCCCTTGTCGGCTGGCGGAGGAAATTCGGGCAGCGTTGGCAGCC
      TCACCTCCTCGGCCTCACCGTCTGCACCCATCCGTAATCCCTTTGCCCCGAACTTCATGGACAGCTTCAACTACTACAAG
      GGCGGCAACAGCAGTGGTCCCAGCGGTAGTTCCAATAACTCGGTTGGCCCAGGTGGCGTCAATAACAATGGCTCCGTGGG
      CCTTGGCTCCGGCGCCGAGTACCCCAACGAACTGTATATGCCCAACGATTACTCCAAGAGCTTTGCCAACCACATGGACA
      TTCCCTCAATCGCACCCGGCGAGCACTGGTTCCAGGGCAAGCTGGAGTTCATGCTGAGCCAGCGAGGCAAGCCGCTGCTG
      GTCCACGACGGGCACACCTTCGGCATTCAGTACGTGCGCAAGGACAAGAAGTACTGGCAGTGCAACCTGTCGCGCAAGTT
      CAACTGCAAGGCGCGCGTGACCACCACGGACACCGGCGACATAATCGTGACCAACAACGAGCACTGCCACACAGAGATAC
      GTCAGCACCTGCGCAAGGATTACCAGCGGAACAAAGTGATGATGAATGCACTGATTAACCTAAGTACGAGTCACATGCGG
      CGAAACAATATGGGTGGGCTGGGTGCCTTGCCCATGGTGCCCGAGGTCCTGACCCAGGGTACACCCATTCACGAGATGGT
      CCAAAACTTACATGACATGGCAGCAAAAGTATCGGCGGGGCAGCAACATCATCATCAACAACAACAACAGCAGCGGGCAC
      ATGACGTGGAGGAGCCACTAGACTGCGGACTCCGATCGTCGGCGGCGCTGGAGGAGATGGCACGCAGCTTCATGACCAAC
      AACAAACCCTCAATTGCCTTTCCGGGCAGCGAATCTGGTCATAACCAGCATGGTAGCGATACCAAAGAGGAACCGTCGTG
      GAAGGAGAAGATCGAGGGCGACGCTTAGGCTTAAATTTACATAAATAGCAGGTCAAATGACAGTTAAGTACAAAAGTGGA
      ATGATTGCAATAATACTCAAATACACTAAAGACGGCGTAACCAAAACAATTCCAAAGAATTTAGTTAATACATAATAAGC
      TAACGTACAATCTGCTAGAGCATTTCCATGAGTTTTATATCGTTTTTATTATTGTACGTTGCATTAGCTTTACACTGTAA
      TAAATGTTGAATTTGAATAAATCTTTTTATATGAACT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0112608
      2550
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0111521
      596
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0111520
      681
      Comments
      Extended 3' UTR based on RNA-Seq and/or EST data.
      Extended 5' UTR based on RNA-Seq and/or EST data.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG34376-RB
      Secondary FlyBase IDs
      • FBtr0084251
      References (0)