General Information
Symbol
Dmel\Hrs-RC
Species
D. melanogaster
Annotation Symbol
CG2903-RC
FlyBase ID
FBtr0089751
Feature type
Associated gene
Evidence Rank
Length (nt)
2665
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 26 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTCTTATTTGCGTTGCCCTTGCTTTTCGTCATCTGGCAGCACTGTAAGGAAAACCAACGACGAGAAGCAGCATAAAAGAA
          AACAGAAAACATGTTTCGATCAAGTTTCGACAAAAACTTAGAAAATGCCACCAGTCACTTGCGTCTGGAGCCCGACTGGC
          CATCAATTCTTCTGATTTGCGATGAAATCAACCAGAAAGATGTCACTCCCAAGAATGCCTTTGCCGCCATCAAGAAGAAG
          ATGAACTCGCCCAACCCGCACTCCTCCTGCTATTCCCTCCTGGTCCTCGAGAGCATCGTCAAGAACTGCGGCGCACCCGT
          TCACGAGGAGGTGTTCACCAAGGAGAACTGCGAGATGTTCAGCAGTTTCCTCGAGTCGACGCCCCACGAGAACGTGCGCC
          AGAAGATGCTGGAGCTGGTGCAGACCTGGGCGTACGCCTTCCGCTCCTCGGACAAGTACCAGGCCATCAAGGACACCATG
          ACCATCCTGAAGGCGAAGGGGCACACTTTCCCCGAACTTCGGGAGGCAGATGCCATGTTCACGGCGGACACGGCGCCCAA
          CTGGGCAGATGGCAGGGTATGCCATCGCTGTCGCGTGGAGTTCACCTTCACCAACCGGAAGCACCACTGCCGGAACTGCG
          GCCAGGTCTTCTGTGGCCAATGCACGGCCAAGCAGTGTCCGCTGCCCAAGTACGGCATCGAAAAGGAGGTGCGTGTGTGC
          GACGGCTGCTTCGCTGCCCTCCAGCGTCCGACGAGCGGCAGTGGAGGCGCTAAGTCCGGACCACGTCCGGCGGACAGCGA
          GCTACCGGCGGAGTATCTGAACAGCACTTTGGCGCAGCAGGTGCAGACACCAGCTCGCAAGACCGAGCAGGAACTCAAGG
          AGGAGGAGGAACTGCAGCTGGCGCTGGCCCTCAGTCAATCGGAAGCGGAGCAGCAGAAGCCCAAGCTGCAATCCCTGCCA
          CCCGCTGCCTATCGCATGCAGCAAAGGTCTCCCAGTCCGGAGGCACCGCCAGAACCCAAGGAGTATCACCAGCAGCCGGA
          GGAGGCTACCAATCCGGAGCTGGCCAAGTACTTGAACCGCAGCTACTGGGAGCAGCGCAAGATCAGCGAATCGTCATCCA
          TGGCAAGTCCCTCGGCACCGAGCCCCATGCCACCAACGCCGCAGCCCCAGCAGATCATGCCCCTGCAGGTCAAGAGTGCG
          GATGAAGTGCAGATCGATGAGTTTGCCGCCAATATGCGCACGCAGGTGGAGATCTTTGTTAACCGCATGAAGTCGAACTC
          GAGCCGCGGTCGCAGCATCTCCAACGACTCCTCTGTGCAGACCCTCTTCATGACCCTGACCTCGTTGCACTCGCAGCAGT
          TGTCGTACATCAAGGAGATGGACGACAAGCGCATGTGGTACGAGCAGCTGCAGGACAAGCTAACCCAGATCAAGGACTCG
          CGTGCTGCGCTGGATCAGCTGCGTCAGGAGCATGTGGAGAAGCTGCGCAGGATCGCCGAGGAGCAGGAACGTCAGCGACA
          GATGCAGATGGCCCAGAAACTGGACATAATGCGCAAGAAGAAGCAGGAGTATCTGCAGTATCAACGACAGCTAGCATTGC
          AGCGCATCCAGGAGCAGGAGCGCGAGATGCAGCTGCGCCAGGAGCAGCAGAAGGCGCAGTATTTGATGGGCCAGTCGGCT
          CCACCTTTCCCCTACATGCCACCATCGGCGGTGCCACAACATGGTTCGCCCTCGCATCAGCTCAACAACGTTTATAATCC
          CTATGCTGCCGGTGTGCCCGGCTATTTGCCTCAGGGTCCTGCACCGGCTCCCAACGGACATGGCCAGTTTCAGGCCATTC
          CGCCGGGCATGTACAATCCGGCAATACAGCAGCCGATGCCGCCGAATCTCCAGCCCGGCGGATTAATGCAACAGCCCGCG
          CCACCTGGAAATCCCCAGATGATGCCGCCCATGCCCGAAAATCAGTTTGCCAACAATCCTGCTGCTATCCTCCAGCTGCC
          GCAGCAGCATTCGATCGCCCAGCCTCCTCAAATACCATTCCAACCGCAGCCTCAACAGATTCCTGGTCAGCAGCCTCAAC
          AGATTCCTGGTCAGCAGCCTCAACAGATTCCTGGTCAGCAGCCTCAACAGATTCCTGGTCAGCAGCCACAGCAGATTCCT
          GTCCAGCAACCTCAGCCACAACCCCAAATGGGTCACGTAATGCTGCAGCAGCACCAGGCTCCTCCAGCAGCACAGGCACC
          TCCAGTTACCGAAATCGCCAACAATCAAGTCCAAGCGGTGGCTGCTGCACCTGCTCCGCCGCAAAACGAACCGGGACCCG
          CGCCCGTTAAAGCTGAGGAGCCGGCTACGGCGGAACTGATTAGCTTTGATTAATCCAAGAGATGTTATTCCATTTGTATT
          ACCCTTCAGGGCTGGGTCAGAAAGTTCTCGTGCGGCTGTTAAGCGAAAAAATGTATGTTTTGTTTAGTTGAACGCGGTTA
          TTAGTTACTATTTCAAAAGTTTTTGTTGCGAGAAAGAGGAACATGATAAATTTTAAGTTTAGACCAAATCTATGGAGGTA
          AAAAGATAGTTGGAAAGTAGTGCTGCACGAGATCGAGGCCCGCCCTTTTATCACGTTTTAACCGACTAATGTTATTCCAC
          AATAAAAATAACTTTGTATTTTGAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089749
          2251
          FBtr0089750
          2714
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0088692
          760
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088690
          647
          FBpp0088691
          760
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG2903-RC
          Hrs-RE
          Secondary FlyBase IDs
            References (2)