General Information
Symbol
Dmel\Zasp66-RA
Species
D. melanogaster
Annotation Symbol
CG6416-RA
FlyBase ID
FBtr0089562
Feature type
Associated gene
Evidence Rank
Length (nt)
1212
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 122 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GAATCAGTTGCGTTCGGAATATTGAAAAATAAACAACAATAAGACTCGAGCTCGAGCATCCTTTTTGTAGTGAATCCTAG
      TGTAAAGATCTCCGATCTCACCAGCTGCAGCGTTGATTTAAACGTGACGAAGAAGAGTTTAAATTCAAACACAAAACACA
      CACATTGCAAAAATGGAGTACGTTCAGTTCAAAAACGGATCCCCAGTCTACTACAAGGAGCAGCCAGACCTCAATGAGTG
      CATTCAATACCAACCCTACCGTACAACTCCGCTGGTCCTGCCCGGCGCCAAAGTGAAGAAGGATGCGCCCACGACAGAGT
      CCTACTTGAGGCACTACCCCAACCCGGCTGTGCGCGCCCACCCAGGACACGACTACCATGACAGTATCATGAAGCAGCGC
      GTGGCCGACACCATGCTGCACAAGGTGGTCGGTTCGGAAGCCGACACTGGCCGCGTCTTCCACAAGCAATTCAACTCGCC
      CATTGGCCTGTACTCCAACAACAACATCGAGGACACCATCAGATCCACAGTTCCCTTCGCCACAAGCGAAAGCAATCGCT
      TGAAGGACAGTCCTTTGCATCGTCCTTTGCCAACAAAACTTAACGGCTATAAGAAAACTGTCCAGTACGATCCCAGGAAC
      AGCGAAACCTACAGAGCCATTCAAGAAGAGGGCGGCTACAGCAACTATGGCCAATCCTCGCCACAGGAAGTGACCATTCC
      TGTGCAGACTAAGGTCTATCAGCCCAATAGATTGGTTCCAGGAAAGAAACCAGTATCAGCGCCAGTATCCCGGCCGCCGT
      ACAATGTGGTAAACACCCACGATGAGAACATACGCCAGAGCGGCTCCTTCAATCGTCTCATGTACAGCGTGATTGGTGCC
      ACCGAGTACTAGAAAGTGCAGCTGCAACACCAGCGACAGCAGCAACATCAACATCAACGCAACATCGGCAACATCTGCTG
      CACTTGTTTTATCTCCTAACATATTTAGCGGATTTTTATGAAATTCTGTTTAACTTACTCAATAAATTATATGAAGAACG
      ACAAGAAATTGTGAACCACTAACAAGCTTGATGATATAATGGATTGGTAATCAATTGGCATCGAAATAAATTTACGATAT
      AAACACCACTTAACGCCGCCTCAACCTAATTACTGTCTGCATATGCAATAGAAAACGTATATAAATTAATTAAATAAAAA
      AAAAAGGAAAGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089568
      1482
      FBtr0089561
      1725
      FBtr0089563
      1714
      FBtr0089564
      786
      FBtr0089565
      1120
      FBtr0089566
      1280
      FBtr0089567
      1352
      FBtr0301154
      1642
      FBtr0301156
      1554
      FBtr0301157
      1793
      FBtr0301158
      1493
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0088530
      239
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0089007
      298
      FBpp0088529
      430
      FBpp0088531
      402
      FBpp0088532
      165
      FBpp0088533
      135
      FBpp0088534
      215
      FBpp0088535
      239
      FBpp0290377
      378
      FBpp0290379
      322
      FBpp0290380
      406
      FBpp0290381
      326
      Comments
      GC splice donor site postulated
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG6416-RA
      Zasp66-RA
      Secondary FlyBase IDs
        References (2)