General Information
Symbol
Dmel\so-RA
Species
D. melanogaster
Annotation Symbol
CG11121-RA
FlyBase ID
FBtr0088970
Feature type
Associated gene
Evidence Rank
Length (nt)
2786
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 25 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTTGTTTTCGAGATTCCGTCGCGTGCGGTTCGCTGCCCGTTCTACCCACGTCGCTCGCTTAGTAATCCAGGCCGGATCC
        GGCGGTCTTTTGACGTCCCGCGCACAAAGTTATATTTAATTTGCGTGTTTCCTGAATGAACGCATCAGTATCGCGCCACA
        TAAACGCACACGAAGCGAGAGAAAAGCGAGCAAAATTGAGCTAATCAATCCGCGGGCGGCCATTTTTTGTTGGCACTGCC
        TCAGTGCTGTCGTCGCAGCTTTGCCCACCAAATTTGCAGGTGCAATTTGTCCGAGTCGCGCAGGACAGCGAAGTTTTCGC
        GAAAAGTAATTTGCAACACGTGTTCGCACAGTGCGTATGAGCAATATTCAACGGCAAGCTTGTGTTAGTTAGTGCCCAGT
        GTGATCGCGACTAAGAGTGTGTGCGTGCGCGAACGGCACATGGCTTCGATTTGAAGAGTTTGGCCAAAATGCAAATCAAG
        GAAATGCCGCACAGCCGAAATCAGCGCCTTCTTGGCCAACTCTAACATTTGCGGATATAGCACAAGTCGAATCGGAAAGC
        CAAGGCAAAAGGCACAAACCCAAACAAAGAGTAACAAACAAAAACTAACAAACTCGGATACGTATCAACAATAAATAATC
        AAAATACAGCGCTCAAAACACCAAAGATTTAGGCAACTACTAGTTTAGGTTACACCATTCACCAGTTCAACTGATCGATC
        CCTTCTGCAACTTGTAGCGGTGTCCTTGAAATCCACCCCACCAACATCCAGCCAGGCAACCGATTCCCGCAGAAAATGTT
        ACAGCATCCCGCCACAGATTTCTACGACTTGGCCGCGGCCAATGCGGCTGCCGTTCTCACCGCCCGTCACACGCCTCCTT
        ATAGTCCCACCGGTCTCAGCGGATCGGTGGCCCTGCACAACAACAACAACAATAACAGCAGCACCAGCAATAACAACAAC
        AGCACTCTGGACATCATGGCGCACAACGGCGGCGGAGCAGGCGGTGGCCTCCATCTGAACAGCAGCAGCAACGGCGGCGG
        CGGCGGCGGAGTGGTCAGTGGTGGAGGCTCCGGCGGCAGGGAGAACCTGCCCAGCTTCGGCTTCACCCAGGAGCAGGTGG
        CCTGTGTTTGCGAGGTTCTCCAGCAGGCGGGCAACATCGAAAGACTGGGCCGCTTCCTCTGGTCGCTGCCACAATGTGAT
        AAGCTGCAGCTGAACGAGTCCGTGCTGAAGGCCAAGGCGGTCGTCGCATTCCACCGGGGACAATACAAGGAGCTGTACCG
        CCTGCTCGAGCATCACCACTTCTCGGCCCAGAATCACGCCAAGCTCCAGGCCCTGTGGTTGAAAGCGCATTATGTGGAAG
        CCGAAAAACTGCGCGGAAGACCCTTGGGTGCTGTTGGCAAATATCGTGTTCGCCGTAAATTTCCATTGCCCCGCACCATC
        TGGGATGGCGAGGAGACGAGCTACTGTTTTAAGGAAAAATCGCGCTCCGTACTGAGGGACTGGTACTCGCACAATCCGTA
        TCCATCGCCGCGGGAGAAACGCGATCTGGCCGAGGCCACAGGACTGACCACCACGCAGGTTTCCAATTGGTTCAAGAACC
        GACGACAAAGAGATCGAGCTGCCGAACACAAAGACGGCTCCACGGACAAGCAGCACCTTGACTCCTCCAGCGACTCCGAG
        ATGGAGGGCAGCATGTTGCCCAGCCAGAGTGCGCAGCACCAGCAGCAGCAGCAACAGCAGCAGCATTCACCCGGCAACAG
        CAGCGGCAACAACAACGGCCTGCATCAGCAGCAGCTGCAGCATGTCGCCGCCGAGCAAGGCCTGCAGCACCATCCGCACC
        AGCCACATCCCGCCAGCAATATCGCCAATGTCGCCGCCACCAAGAGCAGTGGCGGCGGCGGCGGAGGAGGCGTGAGTGCG
        GCGGCCGCTGCCCAGATGCAAATGCCTCCACTGACCGCCGCCGTGGCCTATTCGCACCTGCACAGCGTGATGGGCGCCAT
        GCCCATGACCGCCATGTACGACATGGGCGAGTACCAGCACTTATGATTCTAGTTGGAGGCGGCCGCTGCCGCCGGTGGCA
        CTGGCGGGGTCAGCGGCGGGGTCAGTGGCGGCAGCAGCAGCAGCTTGAGCGGCAGCAACATCGCCTTGCAGCAGCGACAA
        CGCCACCAGCAGCAGCAGCAGTGCGAGAGCTTCTACTTCTGAGGTGGTGGTTGGCCACCAAGCAATATCGCCGGACTCCT
        TCGGCACAGCAGCACAAACTTTACATATCGCCCGATTGCTGGAAGGCTGTCATGAGTGGATATTCAGCTTCCAAATGCTT
        GGCAAGGGGATTCTGGCTGGCGATCCGATGGAGAACTACATGGCCCGGGAAACCATATCAAACCGCAGTGGCAATTGGGT
        CAGCCAACCCAGAAATTCAAGTATCGGCCATGACAGTATTTTAGCCAATTGCCGATATGCCATTATAGCCCCACACTTTC
        CGGATAACATGGCATTTCCGCAACCAGAGATAGAGATATATAGAATTGGAGCTGCAGCACAATCTCCTGGAAGGATTCCA
        GGGGGAAACTATGAACTTTCAACTATGACTTCTGCATCGATCTGTGTAAATAGCTAGGCTTTAGTTTTTAGTGCGGTTGG
        GAGGCCGACCGAAATGCAAATCAAATCGAAACGTGCAAAAATTAAATGTAAACCTACGTACATGCATAAATTATACACTT
        TTAATTGTAGCCCCTAGTAATTCTATTTTTGTTAAAAATAAATTCTATTAAATTATTTTCAAATGC
        
        Other Products of this Gene
        Other Transcripts
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0089177
        416
        Derived from OTHER transcripts
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG11121-RA
        so-RB
        Secondary FlyBase IDs
        • FBtr0005092
        References (2)