General Information
Symbol
Dmel\CG2201-RB
Species
D. melanogaster
Annotation Symbol
CG2201-RB
FlyBase ID
FBtr0085923
Feature type
Associated gene
Evidence Rank
Length (nt)
2027
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 38 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TCAGTTTGTTTTCGTACGCCCAGCTGGGAACTACTAACTGCTAAGAGCTCAACGAAAAGACTAACTGTGTGCCTTCGCTA
      CATTTTTTAAATTTATATAATACGATTTCTATCATATAGTACATAAATATTTGGATAAACTACGCGTAGCATGAAACAGC
      GAAATCTTAGGAATAATAAAGCACTCAAACGCCTCCAGCAGCCAGATAATAAAAATCTAAATTGTTGCTTGAGTAAACGT
      TGCAACTATGAAAATATCTGGCAGCATTTCAATAGCAATGCCACCCTTGAGGAAATTCGACATGCGGCCGCGCGTATTTG
      CCGAGACTATCTAACTGGGCCCTGGAAAGTGGTTACTCCGGAGAGTTTGGTAGTGAAGCGCATAAGTGGCGGGCTGTCAA
      ATTTCTTGTATTACGTAAGCCTTCCCGATTTAAATGACTACGATGAGCTGGACGAACAGAAACAGCAGCAGGAAGACATC
      ATAGGGGCCACCGCAACTGTGACCAATAGAAGCGGAGTTTTCATACACGACGATGAGTCGGCTGCCAAGGCGGTGGGCGT
      AACATTGATGGCGAGGGAATTAATAAATAACGATGACGTCGCCGACGCAGCTCCTGGCGCCACACAAGCACACAAACGTC
      AGCGATGCGATAGTAATAGTCGCGAATGCAGTTCTTCGAAACGATTGCACGCCCCCAAGCAGCAACCCCGTGAGGTCCTT
      CTGCGAATATATGGTCAGACCCATGGTGATCACGCCCTGGAGAGCATGATTACCGAGTCCGTGGTTTTCGCCCTTCTCAG
      TGAACGGAACTATGGGCCCAAACTGCACGGAATCTTTCCGGGCGGACGTATTGAACAATATATTCCGGCACGCGCTTTGA
      CCACAGCAGAATTGGGAGAGCAACGAATATTAAAGAGAGTGGCTGAGAAAATGGGTGAGATCCACAGTCTTAATATACCC
      ATGTCTAAGGAGCCCGATTGGATTTGGAATTGTATGCAGCGTTGGGTTTCCGGTTTAGAGAGCATTGTTAACGGCAGTGT
      CCAAACGAATCAAAAATCTTCGGTACTGAAGAAGCAAATGGAATTGATGCGGACCTTTGACTACGTTCAAGAGATGGCCT
      GGATTAGGTCGATTATCGATGAAGGAGATTATCCAGTTGTGTTCTGTCATAATGATCTGCAAGAAGGTAATATTCTGATG
      CGACAACCGTCAGCTGGTCAAAACGAACGGACCCCCCGGGAGTCAATCAGTAGCCTGAGATCCAACTTCGACGAAACTTT
      GGGTGATAGCCTTGATGGAAATAGCAATATATCGGATACGGAGACACACAAATCACGTAGCGTGTCGCCTTCACCATGCC
      CGGAGTTGGACACTACGAATGACTCAGCCCTGGATTCCAGCTTCATGGCCGATAATGAGCCGGATCTTATTATCATCGAC
      TTTGAGTATTGTGCCTACAACTACCGTGGCTATGATCTTGCCAATCATTTTATTGAGTGGACTTTCGACTACACTAACCC
      ACAGTTCCCTTACTTCTACCACAACTCCAGCAACTGCGCAACTGTTCAGCAACGGCGCGACTTCATTGTAAACTATTTAA
      AGAAATTTCACGATGACGAGAACTATAATATCACTGGCCAGGAGTTGATGAAGGTAGACGCTGAGATTCAGTTCTTTACA
      ATGCTGTCTCATCTGTTCTGGAGCCTTTGGTCCGTAATTAATGTCACATCGGCGATTGAGTTTGGTTATTGGGAATATGG
      TATTGCTCGAATTTTGGAATATCAAAAGCTAAAGGCAGCTTATCAAGCTAATTAAGACAAATATCTGAACCTTTATATAA
      ATCGAATCAGAACCATAGTTAACTAGCCTAGACTTAATTGACCTTGCAATACCTGTCCGTCTTTGTCCGTGTCTAGAAAT
      ATTTTTAACTAAAAATGTTTGAATAGTTCATACAAAACATTAAATAACATCGAACTACTTTAAAAGACTATTAAAATTTG
      TAATAAATAATTTATTTTACATAATTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0085921
      2010
      FBtr0085922
      1814
      FBtr0100511
      1476
      FBtr0305503
      2561
      FBtr0345685
      2463
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0085277
      554
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0085275
      518
      FBpp0085276
      415
      FBpp0099951
      240
      FBpp0293955
      554
      FBpp0311734
      518
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG2201-RB
      Secondary FlyBase IDs
        References (2)