General Information
Symbol
Dmel\Pp1α-96A-RA
Species
D. melanogaster
Annotation Symbol
CG6593-RA
FlyBase ID
FBtr0084642
Feature type
Associated gene
Evidence Rank
Length (nt)
2221
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 144 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Sequence
      GCGCTGTAAACAATCGACGTCACTAACCAACGTAGATGAAAATTTTTTAGTACGTCGCGAGTAAAACGTGCATTAAATGC
      AATAAAAGGGCAGCTGGCTAAGGATCGGAACGATTGAAGTCAGCCAACCTCAGAGGGGTGAGCAACCGAGGCAGTGAATC
      CGCGAATCCGTGCATCCAGCTGACCAAAGGGCGAGATTAGCCCAGCACCGAGTTTCCATCCGCACACGGACACGGCGCAC
      ACACACACAGGCACACGCAGCCCGTGCCCATCGATGAAATAACATACATAACGAACGTATACCGAAAATACACGGGTTAC
      GGGAAATAGCAGTTGCTGCAATCGGCGGATAAGCGAACTTCAGGAAGCTGAGCAAGCGGGCCCACAAAGATGTCGGATAT
      CATGAACATCGACAGTATCATCTCGCGCCTGCTGGAGGTGCGCGGTGCACGACCGGGAAAGAATGTTCAGCTATCAGAGA
      GCGAGATCCGCAGCCTGTGCCTCAAGTCCCGCGAGATATTCCTGTCGCAGCCCATACTCCTGGAGCTGGAGGCACCGCTG
      AAGATCTGCGGCGACATACACGGACAATATTATGACCTCTTGCGCCTGTTCGAATACGGCGGCTTTCCGCCCGAGTCAAA
      CTACCTGTTCCTGGGCGACTATGTCGATCGCGGCAAGCAATCCCTGGAGACGATATGCCTGCTGCTGGCCTACAAGATCA
      AGTACGCGGAGAACTTCTTCTTGCTGCGCGGCAACCATGAGTGCGCCAGCATCAATCGCATCTACGGGTTCTATGACGAA
      TGTAAACGTCGCTACACCATCAAGCTGTGGAAAACTTTCACGGACTGCTTCAACTGCCTGCCGGTGGCCGCCATCGTGGA
      TGAGAAGATCTTCTGCTGCCACGGTGGCCTGAGTCCAGATCTGTCGTCCATGGAGCAGATACGACGCATCATGCGTCCCA
      CAGACGTGCCCGATCAGGGACTGCTGTGCGATCTGCTGTGGTCGGATCCGGATAAGGATACCATGGGCTGGGGCGAGAAT
      GATCGCGGCGTGAGCTTCACATTTGGAGCAGAGGTTGTGGGTAAATTTTTACAGAAGCACGAATTTGACCTGATCTGTCG
      GGCTCATCAGGTAGTGGAGGACGGTTATGAGTTCTTCGCCAAACGTCAGCTGGTGACGCTCTTCTCGGCGCCCAACTACT
      GCGGGGAATTCGACAACGCGGGTGCCATGATGTCCGTGGACGACACATTGATGTGCTCCTTCCAGATATTGAAACCCGCC
      GACAAGCGACGATTTGTTTATCCCAACTTTGGCAGCTCAGGACGTCCTTTGACACCGCCACGCGGAGCTAACAATAAAAA
      CAAGAAAAAATAAACACTGCACACCTCGAACGAAGCACAACAACAACAGCAACTACAAACGGCCACACACACAAAACACA
      AATAGGGAAAACAGAAAGGAGAATCCGTGTGTCCACATTCAACGGAAAGCGCAGAGAGTTTGTTTTTATCATAAACGTGT
      AATCGAATCGTGAGCAACGTTATATGGGGAATATGAATCTACACAAATTAGCCTATCTTTCATTTGAAAAGGAAAAAAAA
      ACAAAAACAAATAAGGAAAACGAAACGAATGAAATGAAATTAAGAAACCAGAAAACACAAATCGAGACACTTTAGTTCAA
      ACTAATGGTAGTGTAAGACACTGCATAAGCAAGAATATTTTATCTCCTAATGTATTAATTTTGTTATAATATTTCCTTGC
      GCAAAACCCACACACTCACACACACACACACACATACACATGCTCAGATCATCCGTACAGTAGGTACCATAAGTGCACGC
      ACCGGTTGTATTTTAATTTGCATTTCCAACTCGCACAGCATTTTAATTATGTATGCCGATCCTGGCGGCACCTTTGGCAA
      AGGTCTTTAACCACACTTCCCTTCTTCCTTGTTTTTTTTTTTTGCGTATCTAAGGGAATATTAGCAAATGGTAACAATGT
      TAAATTTTATGTTAATTAAACTGTACGAGAATGCTTTTAAATGTGAGTTGAGGTTACTACATATTACATATGTATGTACT
      CGAAGCACGATTTATTTTTGTAATATTTGACATCGATACATGTTTACTTAGTTTTAAAACGAGGAAAGCAATTTTAGTTG
      CAAGCTACAAAAGCTTGAATTGTTTACACCAAAAATATTAAAATAAACAAATATTGTGAAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0334334
      3210
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0084026
      327
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0306442
      327
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG6593-RA
      Pp1α-96A-RA
      Secondary FlyBase IDs
        References (2)