General Information
Symbol
Dmel\snRNA:U1:95Cc-RA
Species
D. melanogaster
Annotation Symbol
CR31185-RA
FlyBase ID
FBtr0084487
Feature type
Associated gene
Evidence Rank
Length (nt)
164
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATACTTACCTGGCGTAGAGGTTAACCGTGATCACGAAGGCGGTTCCTCCGGAGTGAGGCTTGGCCATTGCACCTCGGCTG
          AGTTGACCTCTGCGATTATTCCTAATGTGAATAACTCGTGCGCGTAATTTTTGGTAGCCGGGAATGGCGTTCGCGCCGTC
          CCGA
          
          Other Products of this Gene
          Other Transcripts
          Comments
          Transcript extent supported by analysis described in FBrf0225755.
          External Crossreferences and Linkouts ( 2 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CR31185-RA
          snRNA:U1:95Cc-RA
          Secondary FlyBase IDs
            References (0)