General Information
Symbol
Dmel\CG5376-RA
Species
D. melanogaster
Annotation Symbol
CG5376-RA
FlyBase ID
FBtr0084292
Feature type
Associated gene
Evidence Rank
Length (nt)
812
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 63 )
Sequence
ACACATCCCAAAAAGCACGGAAAACGCACATTGCTCTACGAATTTTTATCATTTAAAAAGAATTCTTCATAAAATGGCCG
ATCATAACGAAGATGAAGCTGTTGGCGGTGACCTAAACAACAATATAACAGCAAATGGGCAGGAGGAAGTGCGTCAGCCG
GAGCAGCCGCAGAACGAACTGCTGGACATGGTTTTCACGTTGGAAAGCGAAAAACAGGCACTACTAGAGGAGTCTCGCAA
ACGGATCGGAGCGCTCCGCAAAGACTTTGAGGAAGCCAAGGCGGAAAATGAGCGTTTAAAGCGGAGAGTGGTCCAGTTGG
AGCAGTCGCTCAAGCAGTCCGTCATGCTGGGCGGCACAGATGCTCCCAAATCACGACAAGAGCAGGAGGAGCTGCTTCTA
AAGGCCAAAACCCTGCTGTTCGAGAAGACCAAGGTGAACAAACAGCAGGAGCAGCAGATATCAGTGCTTAGGACACAAGT
AGACTCGATTAAGGATGTGCTGCAGGTGACCAAGGACATGTTGCAGCTAAAGACCGCCGAATGTGATCACACGCAGGCTC
GTCTGGAGAAGAGCCAGCAGTGGATCAAGGCGGAGCAAGACAAGTGTGTGCTCACGGAGAAGAAACTAGCCATCTCCAAA
GGAGTGTATGACAAGCTGCGTTCGGAGTACGACACCCAGTCACAGATATTCAAGGATCTTAAGTCCGCGTACGAGCAGAA
GGTCAAGGTTCTCACCAAGGCTTTGGCAGAAGCCAAGAAATAGCTGAACAATTTAATAAACTACGTTAATTAAATGCACA
CATCTCGTTAAT
Other Products of this Gene
Other Transcripts
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0083685
229
Derived from OTHER transcripts
Comments
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG5376-RA
Secondary FlyBase IDs
    References (2)